Entry information : MePrx121 ( cassava4.1_030462m)
Entry ID 9079
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-03 (Christophe Dunand)
Peroxidase information: MePrx121 ( cassava4.1_030462m)
Name (synonym) MePrx121 ( cassava4.1_030462m)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx121
start..stop
S start..stop
RcPrx13 559 0 17..318 16..317
MePrx02 555 0 8..318 7..316
PtPrx44 540 0 7..318 6..317
GhPrx23 533 0 3..318 2..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1229861..1230070 210 N° 2 1229556..1229744 189 N° 3 1229306..1229468 163 N° 4 1228820..1229211 392
complement(join(1228820..1229211,1229306..1229468,1229556..1229744,1229861..1230 070))


exon

Literature and cross-references MePrx121 ( cassava4.1_030462m)
DNA ref. Phytozome 12:   scaffold06512 (1230070..1228820)
Protein sequence: MePrx121 ( cassava4.1_030462m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (294)
PWM (Da):   %s   34299.43 (31807.1)  
PI (pH):   %s   9.56 (9.56) Peptide Signal:   %s   cut: 25 range:25-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASVLLALFFSSILIFSIISPGNALSLNYYKETCPDVDSIVRDAVKKAAMKDKTVPAALLRMHFHDCFIRGCDGSVLLSSKGSNKAEKDGPPNVSLHAFYVIDNAKKEVEASCPGVVSCADILALAARDAVVLSGGPTWDVPKGRKDGRTSKASETIQLPAPTFNISQLQQSFSQRGLSMSDLVALSGGHTLGFSHCSSFKNRIYNFNATHDIDPTMNPSFAAMLRSICPKKNNPKNAGSTMDPSSTTFDNTYFKLILQGKVLFSSDQTLLTSTRTKALVSNFASSKETFYKAFVKSMIKMSSITGGQEVRKDCRVV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTGTTCTTCTTGCCTTATTCTTCAGCTCAATTCTCATATTTTCGATTATTTCACCAGGCAATGCGCTGAGTTTGAATTACTACAAAGAAACATGTCCCGATGTTGACTCCATT
GTTAGAGATGCAGTCAAGAAAGCTGCCATGAAAGATAAAACAGTCCCTGCAGCTCTGCTTCGCATGCATTTCCATGACTGTTTTATAAGG
GTTAGTATCATAATTAATTAATCACCAAGC
ACTTAACTCATATTGCATTTCTTTCAAGGTAACGTTTTTGATATGTGTTCTTACATAATTGTTTCCTTTGAATTTGTTGTCTCAAGGGCTGTGATGGGTCTGTGCTGTTAAGTTCCAAAG
GCAGCAACAAAGCAGAGAAGGATGGACCTCCAAATGTTTCTTTGCATGCTTTTTACGTCATTGACAATGCCAAGAAAGAAGTGGAAGCTTCGTGCCCTGGGGTGGTGTCTTGTGCTGATA
TTTTGGCATTAGCAGCAAGGGATGCAGTTGTACTA
GTAAGATATTTTAATTATGGGACAGAAAACTGAAACGTCGAAGCAAAATCTCGAGTTTTGATTCTAATACGTGTAGCTTTTCTGC
AGTCTGGAGGACCAACATGGGACGTCCCAAAAGGAAGAAAAGATGGAAGAACATCAAAAGCAAGCGAAACAATACAATTGCCAGCTCCAACTTTTAACATCTCTCAGCTCCAGCAAAGCT
TCTCCCAAAGAGGCCTGTCCATGAGTGATCTAGTTGCTCTTTCAG
GTAAAGAAACTAAAACCCAAAAACTATTCTTACTTCTATTTCATCATTACAAACAAGAAAATTCAGACAAGCTTA
CCAAGTTACTGATGTGCAGGTGGTCATACTCTAGGGTTTTCTCACTGTTCATCCTTCAAAAACAGAATATACAATTTCAATGCTACTCATGACATAGATCCCACCATGAATCCATCATTT
GCTGCAATGTTAAGGAGTATTTGCCCAAAAAAGAATAACCCTAAGAACGCAGGTTCCACCATGGACCCTTCTTCAACGACCTTTGATAACACATATTTCAAGTTGATCCTACAAGGGAAG
GTCCTGTTCTCTTCAGACCAAACTCTGCTCACGAGTACTAGGACTAAAGCTTTGGTCTCAAATTTTGCTAGTTCAAAGGAAACTTTCTACAAAGCGTTTGTGAAATCCATGATCAAAATG
AGTAGCATCACAGGAGGCCAGGAGGTTAGGAAGGACTGCAGGGTGGTAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTGTTCTTCTTGCCTTATTCTTCAGCTCAATTCTCATATTTTCGATTATTTCACCAGGCAATGCGCTGAGTTTGAATTACTACAAAGAAACATGTCCCGATGTTGACTCCATT
GTTAGAGATGCAGTCAAGAAAGCTGCCATGAAAGATAAAACAGTCCCTGCAGCTCTGCTTCGCATGCATTTCCATGACTGTTTTATAAGG
GGCTGTGATGGGTCTGTGCTGTTAAGTTCC
AAAGGCAGCAACAAAGCAGAGAAGGATGGACCTCCAAATGTTTCTTTGCATGCTTTTTACGTCATTGACAATGCCAAGAAAGAAGTGGAAGCTTCGTGCCCTGGGGTGGTGTCTTGTGCT
GATATTTTGGCATTAGCAGCAAGGGATGCAGTTGTACTA
TCTGGAGGACCAACATGGGACGTCCCAAAAGGAAGAAAAGATGGAAGAACATCAAAAGCAAGCGAAACAATACAATTGCCA
GCTCCAACTTTTAACATCTCTCAGCTCCAGCAAAGCTTCTCCCAAAGAGGCCTGTCCATGAGTGATCTAGTTGCTCTTTCAG
GTGGTCATACTCTAGGGTTTTCTCACTGTTCATCCTTC
AAAAACAGAATATACAATTTCAATGCTACTCATGACATAGATCCCACCATGAATCCATCATTTGCTGCAATGTTAAGGAGTATTTGCCCAAAAAAGAATAACCCTAAGAACGCAGGTTCC
ACCATGGACCCTTCTTCAACGACCTTTGATAACACATATTTCAAGTTGATCCTACAAGGGAAGGTCCTGTTCTCTTCAGACCAAACTCTGCTCACGAGTACTAGGACTAAAGCTTTGGTC
TCAAATTTTGCTAGTTCAAAGGAAACTTTCTACAAAGCGTTTGTGAAATCCATGATCAAAATGAGTAGCATCACAGGAGGCCAGGAGGTTAGGAAGGACTGCAGGGTGGTAAAT

Retrieve as FASTA