Entry information : MePrx127 ( cassava4.1_031318m)
Entry ID 9085
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-19 (Christophe Dunand)
Peroxidase information: MePrx127 ( cassava4.1_031318m)
Name (synonym) MePrx127 ( cassava4.1_031318m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx127
start..stop
S start..stop
MePrx88 587 0 7..324 2..319
AcoPrx115 508 0 1..324 1..325
LePrx91 508 0 5..324 6..324
CclPrx83 507 0 1..324 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 80034..80246 213 N° 2 79750..79941 192 N° 3 79500..79665 166 N° 4 78972..79375 404
complement(join(78972..79375,79500..79665,79750..79941,80034..80246))


exon

Literature and cross-references MePrx127 ( cassava4.1_031318m)
DNA ref. Phytozome 12:   scaffold09365 (80246..78972)
Protein sequence: MePrx127 ( cassava4.1_031318m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (310)
PWM (Da):   %s   35279.07 (33678.1)  
PI (pH):   %s   7.94 (7.68) Peptide Signal:   %s   cut: 16 range:16-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSSLILLFISLALAYEVGVCDGGELRKYFYKNTCPQAEDIVRTIIWQSVASNSALPAKFLRMHFHDCFVRGCDASILLDSTPDNTAEKAAIPNLSLAGFDVIDKAKAQLEKTCPGVVSCADIVALAARDSVSFQFKKPIWEVLTGRRDGSISRASEALSNIPSPFFNFTLLKQSFASKSLTVHDLVVLSGGHTIGVGHCNLFSNRLYNFTGKGDADPSLNPTYASFLKTQCRSLADNTTIVPMDPLTPLTFDNNYFKILKLNEGLFQSDAALLTNKGSSNIVDELLDSAKFFTEFAQSIKRMGSIGVLTGSAGEIRKNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (Short 5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAGTAGCTTAATTCTCTTGTTCATCTCTCTGGCATTAGCTTATGAAGTGGGAGTTTGTGATGGAGGGGAATTAAGGAAATATTTTTACAAGAATACTTGTCCCCAGGCTGAGGAT
ATTGTCAGGACTATCATTTGGCAGAGTGTCGCAAGCAATTCAGCATTGCCTGCCAAGTTCTTGAGGATGCATTTCCACGACTGTTTTGTCAGA
GTAAATTTTTCTCCATCGTATATCATT
TAAATATTCTACAACTCTAGTACCATTACGATACAATATATTTGATTACCTTATGATATTGGCAGGGTTGTGATGCCTCTATATTGCTGGATTCCACGCCAGATAACACAGCAGAAAAGG
CAGCAATCCCAAACCTATCCCTCGCAGGATTTGATGTGATAGATAAGGCTAAGGCCCAGCTAGAGAAGACATGCCCTGGAGTGGTTTCTTGTGCAGATATTGTTGCTCTAGCTGCTAGAG
ATTCTGTCTCCTTCCAA
GTAAGTTAAGTAGCTTCAATTTCATGCATGGCCCCNNNNNNNNNNNNNNNNNNNNNNCCTTGTTTTGTTACTGTGGACAATCAGTTTAAAAAGCCAATTTGGG
AAGTGCTTACTGGTAGAAGAGATGGATCAATTTCTCGAGCGTCAGAGGCTCTCTCCAACATCCCTTCACCTTTCTTCAATTTCACTCTTCTCAAACAATCCTTTGCCAGCAAAAGCCTAA
CAGTTCATGACCTTGTCGTGTTATCAG
GTAAATATTTTATTGGAAATATTTGTCCGAATTTGGTACATTGTGAATCAAAACGCATACAAGTGGGTTTCTCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGTATGATTGGCAAGGTGGACACACCATTGGAGTAGGACACTGCAATTTATTCAGCAACAGATTATACAACTTCACAGGAAAAGGTGACGCAGATCCTTCTCTG
AATCCAACCTACGCTTCTTTCTTGAAAACTCAATGCAGAAGCCTTGCAGACAACACAACAATAGTTCCAATGGATCCCTTGACTCCCTTAACTTTCGACAACAATTACTTCAAAATCCTC
AAGCTTAACGAAGGCCTTTTCCAATCTGATGCTGCACTTCTCACCAACAAGGGCTCTAGCAATATCGTAGATGAATTGCTTGACTCTGCCAAGTTCTTTACTGAATTTGCTCAATCCATT
AAGAGGATGGGATCCATTGGAGTGCTCACTGGTAGTGCTGGAGAGATCAGGAAGAACTGTAGGGTGGTGAATTAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAGTAGCTTAATTCTCTTGTTCATCTCTCTGGCATTAGCTTATGAAGTGGGAGTTTGTGATGGAGGGGAATTAAGGAAATATTTTTACAAGAATACTTGTCCCCAGGCTGAGGAT
ATTGTCAGGACTATCATTTGGCAGAGTGTCGCAAGCAATTCAGCATTGCCTGCCAAGTTCTTGAGGATGCATTTCCACGACTGTTTTGTCAGA
GGTTGTGATGCCTCTATATTGCTGGAT
TCCACGCCAGATAACACAGCAGAAAAGGCAGCAATCCCAAACCTATCCCTCGCAGGATTTGATGTGATAGATAAGGCTAAGGCCCAGCTAGAGAAGACATGCCCTGGAGTGGTTTCTTGT
GCAGATATTGTTGCTCTAGCTGCTAGAGATTCTGTCTCCTTCCAA
TTTAAAAAGCCAATTTGGGAAGTGCTTACTGGTAGAAGAGATGGATCAATTTCTCGAGCGTCAGAGGCTCTCTCC
AACATCCCTTCACCTTTCTTCAATTTCACTCTTCTCAAACAATCCTTTGCCAGCAAAAGCCTAACAGTTCATGACCTTGTCGTGTTATCAG
GTGGACACACCATTGGAGTAGGACACTGC
AATTTATTCAGCAACAGATTATACAACTTCACAGGAAAAGGTGACGCAGATCCTTCTCTGAATCCAACCTACGCTTCTTTCTTGAAAACTCAATGCAGAAGCCTTGCAGACAACACAACA
ATAGTTCCAATGGATCCCTTGACTCCCTTAACTTTCGACAACAATTACTTCAAAATCCTCAAGCTTAACGAAGGCCTTTTCCAATCTGATGCTGCACTTCTCACCAACAAGGGCTCTAGC
AATATCGTAGATGAATTGCTTGACTCTGCCAAGTTCTTTACTGAATTTGCTCAATCCATTAAGAGGATGGGATCCATTGGAGTGCTCACTGGTAGTGCTGGAGAGATCAGGAAGAACTGT
AGGGTGGTGAATTAT

Retrieve as FASTA