Entry information : MePrx130 ( cassava4.1_031448m)
Entry ID 9088
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-24 (Christophe Dunand)
Peroxidase information: MePrx130 ( cassava4.1_031448m)
Name (synonym) MePrx130 ( cassava4.1_031448m)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx130
start..stop
S start..stop
MePrx73 635 0 1..322 1..322
MePrx66 632 0 1..322 1..322
RcPrx18 540 0 1..323 1..325
RcPrx88 539 0 1..323 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1649935..1650141 207 N° 2 1649603..1649794 192 N° 3 1649364..1649529 166 N° 4 1648868..1649271 404
complement(join(1648868..1649271,1649364..1649529,1649603..1649794,1649935..1650 141))


exon

Literature and cross-references MePrx130 ( cassava4.1_031448m)
DNA ref. Phytozome 12:   scaffold11998 (1650141..1648868)
Protein sequence: MePrx130 ( cassava4.1_031448m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (302)
PWM (Da):   %s   34948.7 (32742.5) Transmb domain:   %s   i5-24o
PI (pH):   %s   7.9 (7.74) Peptide Signal:   %s   cut: 22 range:22-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTPFLFVCVIALSVIGVCQGGALRKKFYKTSCPQAEDIVRRVTWSHVLSNPNLPAKLLRMHFHDCFVRGCDGSILLNSTATSTAEKDAIPNLTLSGFDTIDAIKSELENACPGVVSCADILALAARDSVSFQFQKPMWEVLTGRRDGNVSLASDVSSNLPSPFFDFSTLLKNFKDKGLNVHDLVVLSGGHTIGIGHCNLFSNRLYNFTGKGDQDPSLNSTYAAFLKTKCQSLSDTTTTVEMDPGSSLNFDSNYFVILRENKGLFQSDAALLTNKIARNIAGELVNSGAFFVEFAESMKRLGAVQVLTGTKGEIRNKCSVAN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCCCTTTTCTCTTTGTCTGTGTGATTGCTTTGAGTGTGATTGGGGTTTGTCAAGGAGGTGCTTTGAGAAAGAAATTCTACAAGACATCATGTCCTCAAGCAGAGGATATTGTC
AGAAGGGTCACCTGGAGCCATGTCTTAAGCAACCCCAACTTGCCTGCAAAGCTTTTGAGAATGCATTTTCATGACTGTTTTGTTAGG
GTAAGACTCATGCATGCATGATTATGTTAGTCT
AAATATATAGTCTTACACTTGAAGATAAGACACTCCCTGAAAGCTTTCTTGTTGTCCAACAAGAAAGAATTCATGACTAATTCACACATTTGGAAATTGAATTTCAGGGCTGCGACGGCT
CTATTTTACTAAATTCCACTGCTACTAGCACTGCGGAGAAAGATGCAATTCCAAATCTAACTTTATCAGGATTTGATACTATTGATGCCATAAAATCAGAGTTAGAGAATGCATGTCCAG
GAGTTGTATCTTGTGCTGACATCTTGGCCTTGGCCGCTAGGGACTCAGTTTCCTTCCAA
GTAAGTATAAGCTGAAAATGAAACCATTTTGTATGTATCATAAAACTAATGCATCTTTTGC
TTCTTGGTGCAGTTCCAAAAGCCAATGTGGGAAGTGCTTACTGGCAGAAGAGACGGCAATGTTTCATTAGCTTCCGATGTCTCTTCTAACCTTCCTTCGCCCTTCTTCGACTTCTCCACC
CTCTTGAAAAATTTCAAGGACAAGGGTCTCAACGTCCATGATCTAGTTGTACTATCAG
GTACATAATATATATTGTCGGTGCCAGGAAATTACTTAGAAAATGATGACATATGTGTATCA
GGGACTAATAAATGCACTTAAATTATGTAGGCGGACACACCATTGGAATAGGCCACTGTAATCTCTTCAGCAATAGGCTCTACAACTTCACAGGCAAAGGCGACCAAGACCCTTCTCTGA
ACTCCACATACGCAGCTTTCCTGAAGACTAAATGCCAAAGTCTTAGTGACACGACCACCACCGTAGAGATGGATCCTGGCAGCTCTCTAAACTTCGATAGCAACTATTTCGTTATCCTTA
GGGAGAATAAGGGTCTATTTCAATCCGATGCAGCCCTTCTAACGAACAAGATCGCAAGAAATATTGCTGGAGAATTGGTTAACTCGGGAGCTTTCTTCGTAGAGTTTGCAGAGTCAATGA
AGAGGTTGGGAGCAGTTCAGGTTCTTACTGGCACTAAAGGGGAGATTAGGAACAAGTGCAGTGTGGCCAATACC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCCCTTTTCTCTTTGTCTGTGTGATTGCTTTGAGTGTGATTGGGGTTTGTCAAGGAGGTGCTTTGAGAAAGAAATTCTACAAGACATCATGTCCTCAAGCAGAGGATATTGTC
AGAAGGGTCACCTGGAGCCATGTCTTAAGCAACCCCAACTTGCCTGCAAAGCTTTTGAGAATGCATTTTCATGACTGTTTTGTTAGG
GGCTGCGACGGCTCTATTTTACTAAATTCCACT
GCTACTAGCACTGCGGAGAAAGATGCAATTCCAAATCTAACTTTATCAGGATTTGATACTATTGATGCCATAAAATCAGAGTTAGAGAATGCATGTCCAGGAGTTGTATCTTGTGCTGAC
ATCTTGGCCTTGGCCGCTAGGGACTCAGTTTCCTTCCAA
TTCCAAAAGCCAATGTGGGAAGTGCTTACTGGCAGAAGAGACGGCAATGTTTCATTAGCTTCCGATGTCTCTTCTAACCTT
CCTTCGCCCTTCTTCGACTTCTCCACCCTCTTGAAAAATTTCAAGGACAAGGGTCTCAACGTCCATGATCTAGTTGTACTATCAG
GCGGACACACCATTGGAATAGGCCACTGTAATCTC
TTCAGCAATAGGCTCTACAACTTCACAGGCAAAGGCGACCAAGACCCTTCTCTGAACTCCACATACGCAGCTTTCCTGAAGACTAAATGCCAAAGTCTTAGTGACACGACCACCACCGTA
GAGATGGATCCTGGCAGCTCTCTAAACTTCGATAGCAACTATTTCGTTATCCTTAGGGAGAATAAGGGTCTATTTCAATCCGATGCAGCCCTTCTAACGAACAAGATCGCAAGAAATATT
GCTGGAGAATTGGTTAACTCGGGAGCTTTCTTCGTAGAGTTTGCAGAGTCAATGAAGAGGTTGGGAGCAGTTCAGGTTCTTACTGGCACTAAAGGGGAGATTAGGAACAAGTGCAGTGTG
GCCAATACC

Retrieve as FASTA