Entry information : MePrx138 (cassava4.1_033835m)
Entry ID 9095
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx138 (cassava4.1_033835m)
Name (synonym) MePrx138 (cassava4.1_033835m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx138
start..stop
S start..stop
MePrx71 649 0 1..325 1..325
MePrx82 629 0 1..325 1..325
MePrx28 602 0 1..325 1..325
MePrx113 588 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 480603..480836 234 N° 2 480924..481115 192 N° 3 481214..481379 166 N° 4 481509..481891 383
join(480603..480836,480924..481115,481214..481379,481509..481891)


exon

Literature and cross-references MePrx138 (cassava4.1_033835m)
DNA ref. Phytozome 11:   scaffold08799 (480603..481891)
Protein sequence: MePrx138 (cassava4.1_033835m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (294)
PWM (Da):   %s   34818.73 (31604.0)  
PI (pH):   %s   8.14 (7.98) Peptide Signal:   %s   cut: 32 range:32-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIPLLNISISPAKAAVFAFVVLLFNTACQAQLTSTFYDNSCPNALKTIRTSIRNSIAAERRMAASLIRLHFHDCFVQGCDASILLEETPTIESEQTALPNKDSARGFRVIEKAKSEVEKICPGVVSCADIVAVAARDASAYVGGPSYTVMLGRRDSTTASRTLANNELPSFKDGLDILISSFQRKGLSARDLVALSGAHTLGHAQCFTFRDRIYNNVSIDAGFASTRKRTCPAIGGDGNLAPFDLVTPNSFDNNYFKNLIQKKGLLESDQILFSGGSTDSIVREYSRSPAAFNSDFAAAMIKMGNIDILTGSAGEIRKICSAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCCACTTCTTAACATTTCAATATCTCCAGCAAAAGCTGCAGTGTTCGCGTTTGTGGTCCTGCTGTTTAACACTGCCTGCCAAGCTCAACTCACCTCTACATTTTATGACAAT
TCTTGTCCAAATGCACTCAAAACTATCCGAACTTCCATCAGAAATTCAATTGCCGCAGAACGAAGAATGGCGGCTTCTCTCATTCGTCTCCACTTTCATGATTGCTTTGTTCAG
GTACAA
TATATATATTGCTCTGTTCTCCTTCCAAAAATAATTAGTTTTATTCTATGAGCATCACTTAATGAATTCTTGATCTTGCAGGGTTGTGATGCATCAATCTTACTCGAAGAGACTCCAACT
ATCGAGAGCGAACAGACTGCACTTCCCAATAAAGATTCCGCCAGAGGTTTTCGAGTCATCGAGAAAGCTAAATCTGAAGTAGAGAAGATATGCCCTGGAGTTGTATCTTGCGCAGATATC
GTCGCCGTGGCAGCAAGAGATGCATCTGCATAT
GTAATTAACTATATTTCAAATTCTTGCGTTCAGATGCTATACTCGTCTCAAGTTATTGTTTATTAATTTTTTTGACATTTTCTTCTG
AAATATGTCAGGTGGGAGGTCCATCTTATACAGTGATGCTTGGAAGAAGAGACTCAACTACTGCTAGCAGAACTCTTGCCAATAATGAACTTCCCAGTTTTAAAGATGGTCTGGACATAC
TTATATCTAGCTTTCAGCGCAAAGGCCTTAGTGCAAGGGATCTGGTTGCCTTATCAG
GTATATATGCTAAAACTATTTTCATGTATTTTGCATTATCATATATCTTACAAGTGATCTTTT
TCTTAGCAAAAAAAAAACATTTCCATGTCTTATATATGCTAAAAATATTTTAATTTCCAAATGCAGGAGCTCATACTCTAGGCCACGCTCAATGCTTTACTTTCCGTGATAGGATATACA
ACAATGTGTCCATTGACGCTGGATTTGCAAGCACTCGCAAGCGCACTTGTCCAGCTATTGGCGGTGATGGAAACTTGGCTCCATTTGATTTGGTCACACCTAATTCTTTCGACAACAATT
ACTTCAAGAATCTTATTCAAAAGAAAGGTCTTCTTGAATCTGATCAAATTCTTTTTAGCGGAGGTTCGACAGATAGCATTGTCCGAGAATATAGCAGGAGTCCTGCAGCTTTCAACTCAG
ACTTTGCTGCTGCCATGATCAAAATGGGAAATATCGATATTCTCACTGGCTCTGCTGGGGAAATAAGGAAGATCTGTAGTGCTGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCCACTTCTTAACATTTCAATATCTCCAGCAAAAGCTGCAGTGTTCGCGTTTGTGGTCCTGCTGTTTAACACTGCCTGCCAAGCTCAACTCACCTCTACATTTTATGACAAT
TCTTGTCCAAATGCACTCAAAACTATCCGAACTTCCATCAGAAATTCAATTGCCGCAGAACGAAGAATGGCGGCTTCTCTCATTCGTCTCCACTTTCATGATTGCTTTGTTCAG
GGTTGT
GATGCATCAATCTTACTCGAAGAGACTCCAACTATCGAGAGCGAACAGACTGCACTTCCCAATAAAGATTCCGCCAGAGGTTTTCGAGTCATCGAGAAAGCTAAATCTGAAGTAGAGAAG
ATATGCCCTGGAGTTGTATCTTGCGCAGATATCGTCGCCGTGGCAGCAAGAGATGCATCTGCATAT
GTGGGAGGTCCATCTTATACAGTGATGCTTGGAAGAAGAGACTCAACTACTGCT
AGCAGAACTCTTGCCAATAATGAACTTCCCAGTTTTAAAGATGGTCTGGACATACTTATATCTAGCTTTCAGCGCAAAGGCCTTAGTGCAAGGGATCTGGTTGCCTTATCAG
GAGCTCAT
ACTCTAGGCCACGCTCAATGCTTTACTTTCCGTGATAGGATATACAACAATGTGTCCATTGACGCTGGATTTGCAAGCACTCGCAAGCGCACTTGTCCAGCTATTGGCGGTGATGGAAAC
TTGGCTCCATTTGATTTGGTCACACCTAATTCTTTCGACAACAATTACTTCAAGAATCTTATTCAAAAGAAAGGTCTTCTTGAATCTGATCAAATTCTTTTTAGCGGAGGTTCGACAGAT
AGCATTGTCCGAGAATATAGCAGGAGTCCTGCAGCTTTCAACTCAGACTTTGCTGCTGCCATGATCAAAATGGGAAATATCGATATTCTCACTGGCTCTGCTGGGGAAATAAGGAAGATC
TGTAGTGCTGTGAAC

Retrieve as FASTA