Entry information : MePrx17(Manes.16G132400 / cassava4.1_011556m)
Entry ID 9099
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-08-22 (Christophe Dunand)
Peroxidase information: MePrx17(Manes.16G132400 / cassava4.1_011556m)
Name MePrx17(Manes.16G132400 / cassava4.1_011556m)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx17
start..stop
S start..stop
RcPrx44 541 0 3..334 1..327
PtPrx52 523 0 3..334 1..334
PtPrx79 512 0 3..334 1..332
EcamPrx73 504 0 3..334 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2208914..2209156 243 N° 2 2207352..2207531 180 N° 3 2207104..2207269 166 N° 4 2206615..2207027 413
complement(join(2206615..2207027,2207104..2207269,2207352..2207531,2208914..2209 156))


exon

Literature and cross-references MePrx17(Manes.16G132400 / cassava4.1_011556m)
DNA ref. Phytozome 12:   scaffold00847 (2209150..2206615)
Protein sequence: MePrx17(Manes.16G132400 / cassava4.1_011556m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334
PWM (Da):   %s   36223.14 Transmb domain:   %s   i13-35o
PI (pH):   %s   4.76
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVMETKTLLFSTLPRLSYVLILVLFSLVAAAASGSLSFNFYAASCPTVEFIVVNTVRSASSSDPTIPGKLLRLVFHDCFVEGCDASVLLQGNGTEQSDPANKSLGGFAVINSAKRLLEIFCPETVSCADILALAARDAVAITGGPMIQIPTGRRDGRESLVANVRPNIVDTSFTMDDMIKIFSSKGLSLEDLVTLSGAHTIGAAHCSAFSDRFQEDSHGKLKLIDSFLDTSYARELMSMCPAGASPSITVNNDPETSSAFDNQYYRNLLAHKGLFQSDSVLLEDERTREQVKDFANDEGRFFESWRQSFLKLTSIGVKTGEDGEIRRFCSEIN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCATGGAGACAAAAACTCTGTTATTTTCTACTCTTCCCCGTTTAAGTTATGTTCTCATTCTTGTTCTCTTCAGTCTCGTTGCTGCTGCTGCTTCTGGTAGCCTATCTTTCAACTTT
TATGCAGCTTCATGCCCAACTGTTGAATTCATAGTTGTAAACACTGTGAGATCGGCATCTTCTTCTGATCCAACAATTCCTGGGAAGCTTCTTCGCTTGGTGTTCCATGACTGCTTTGTG
GAG
GTGAGTGCATTTTTCACCCAAATGGAGAATTTGGATATGCCACTTAAAGAACTTGTTAAAGTAGTTGGCGTATGCTTATATCATCCACCTTTGTAGAAGCAACACGCTCACGCATAT
GCACAATTCTTATTCATTACTTGCTCAATTCAGAAATGAATAAAACTATGCCCAGGAAGATTACAGGATAAATTGATTGAATCAAAATCTGCATATATGCTTCTCGTTTTTTGTGAGTTT
GAGTTCGCTCTTGATACAGAATGGACACTGCACTTCCAAGAATTTAAGGCATGAAATTGCTTGTGAGAAAAAAAAACAAATTTCCCTAGAAATAAATTGTAAGAGAAAATTCAGCTGTTA
AGGCATGCCTCTGGCCCAGAAAAGACTCACTAGATTATCCTGTGTACAGATTTACTGGTCTCTCCACTTCACACACTTCAGCCACCCACCGAATCAATAAGCAAATTCTTATCATCTTTG
CACTCGAAGCCACCTGATGGGTGATTGTCCAGAGTTGGCTCGACCATTCTTTTTTCCTATCAATCCAAAGAAAATGCATGAATTATCCTTCATAAACAAAGTGACAATATGTGTAACAGC
CCGGACTGGCTCCAGCGCTGTTACCACTCACAGCCCGTTACACCTCCTGGGGGCGGCCACTGTGAGCAGCTCTTAACATCCTCTCACCCTCACGGGCTCTTGAGGCAGGATTTGTCCCTC
GGGGGAGCCACTACGGCCCACCCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCAATATGTTTACCGGCACAGCAGAATGTAATCTGAAATGCTTGCAGGGTTGTGACGCATCTGTGCTGCTGCAAGGAAATGGGACGGAGCAAAGTGATCCAG
CAAACAAGTCTCTTGGAGGATTTGCAGTTATCAATTCAGCTAAAAGACTACTTGAAATATTCTGTCCAGAAACTGTTTCTTGCGCTGATATTTTGGCTTTGGCTGCGAGAGATGCTGTTG
CAATT
GTAATATTCCTGGTGTTTTTGTTATTCCATACTACTGCATTTACATGCTTCTTCTTGTTGATCATTCAATATATGAAAACAGACAGGAGGACCAATGATCCAGATTCCAACAGGT
AGGAGAGATGGGAGGGAATCTTTAGTTGCAAATGTGAGACCAAACATTGTAGATACAAGTTTTACAATGGATGATATGATCAAAATCTTCTCCTCTAAAGGATTATCCCTGGAAGACCTT
GTTACCCTTTCAG
GTAATGCAACTGCAAACTTCTGATTTCTGCTCACATTCAAGAGTAGCTCTGTTTAATGGATTCAAGGCTTTTGCAGGTGCTCATACTATAGGAGCAGCTCATTGCAG
CGCATTCAGCGATCGGTTCCAGGAAGATTCTCATGGAAAGCTCAAACTCATTGACTCATTTCTAGACACCAGTTATGCAAGAGAGCTAATGAGCATGTGTCCAGCAGGAGCAAGTCCATC
AATAACAGTTAACAATGATCCTGAAACATCCTCTGCCTTTGATAATCAATATTATAGAAATCTGTTAGCCCATAAAGGGCTTTTCCAATCAGATTCTGTTCTTTTAGAGGATGAAAGAAC
AAGGGAACAAGTAAAGGATTTCGCTAATGATGAAGGCAGGTTTTTTGAGAGCTGGAGACAGTCATTTTTGAAGCTAACTAGCATTGGAGTTAAGACAGGGGAAGATGGTGAAATTCGACG
ATTTTGTTCAGAGATTAATGGG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCATGGAGACAAAAACTCTGTTATTTTCTACTCTTCCCCGTTTAAGTTATGTTCTCATTCTTGTTCTCTTCAGTCTCGTTGCTGCTGCTGCTTCTGGTAGCCTATCTTTCAACTTT
TATGCAGCTTCATGCCCAACTGTTGAATTCATAGTTGTAAACACTGTGAGATCGGCATCTTCTTCTGATCCAACAATTCCTGGGAAGCTTCTTCGCTTGGTGTTCCATGACTGCTTTGTG
GAG
GGTTGTGACGCATCTGTGCTGCTGCAAGGAAATGGGACGGAGCAAAGTGATCCAGCAAACAAGTCTCTTGGAGGATTTGCAGTTATCAATTCAGCTAAAAGACTACTTGAAATATTC
TGTCCAGAAACTGTTTCTTGCGCTGATATTTTGGCTTTGGCTGCGAGAGATGCTGTTGCAATT
ACAGGAGGACCAATGATCCAGATTCCAACAGGTAGGAGAGATGGGAGGGAATCTTTA
GTTGCAAATGTGAGACCAAACATTGTAGATACAAGTTTTACAATGGATGATATGATCAAAATCTTCTCCTCTAAAGGATTATCCCTGGAAGACCTTGTTACCCTTTCAG
GTGCTCATACT
ATAGGAGCAGCTCATTGCAGCGCATTCAGCGATCGGTTCCAGGAAGATTCTCATGGAAAGCTCAAACTCATTGACTCATTTCTAGACACCAGTTATGCAAGAGAGCTAATGAGCATGTGT
CCAGCAGGAGCAAGTCCATCAATAACAGTTAACAATGATCCTGAAACATCCTCTGCCTTTGATAATCAATATTATAGAAATCTGTTAGCCCATAAAGGGCTTTTCCAATCAGATTCTGTT
CTTTTAGAGGATGAAAGAACAAGGGAACAAGTAAAGGATTTCGCTAATGATGAAGGCAGGTTTTTTGAGAGCTGGAGACAGTCATTTTTGAAGCTAACTAGCATTGGAGTTAAGACAGGG
GAAGATGGTGAAATTCGACGATTTTGTTCAGAGATTAATGGG

Retrieve as FASTA