Entry information : MePrx24 (cassava4.1_011768m)
Entry ID 9103
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-10 (Christophe Dunand)
Peroxidase information: MePrx24 (cassava4.1_011768m)
Name (synonym) MePrx24 (cassava4.1_011768m)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer Drought
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx24
start..stop
S start..stop
MePrx25 612 0 1..326 1..326
RcPrx71 593 0 5..326 2..324
PtPrx27 558 0 1..326 1..327
QrobPrx01 556 0 1..318 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31060..31269 210 N° 2 30783..30974 192 N° 3 30115..30690 576  
complement(join(30115..30690,30783..30974,31060..31269))


exon

Literature and cross-references MePrx24 (cassava4.1_011768m)
DNA ref. Phytozome 12:   scaffold06906 (31269..30115)
Cluster/Prediction ref. UniGene:   Mes.8132
Protein sequence: MePrx24 (cassava4.1_011768m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (303)
PWM (Da):   %s   34960.54 (32713.3)  
PI (pH):   %s   7.06 (7.06) Peptide Signal:   %s   cut: 24 range:24-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGGFGSLGILVLAILAYIASTQAQLQIGFYSQSCPRAEQIVQDFVNQHIHNAPSLAATFIRMHFHDCFVRGCDASVLINSTSNNQAEKSATPNLTLRGFDFIDRVKSLLEAECPGVVSCADTIALVARDSIVATGGPSWNVPTGRRDGTISNSSEALANIPPPTSNFTNLQRLFANVGLDLKDLVLLSGAHTIGIAHCPSFSNRLYNFTGVGDQDPALDSEYAANLKARKCTTPNDNTTIVEMDPGSRKTFDLSYYSNLLKRRGLFQSDSALTTNSATLATINQLLSGSLQNFYSEFAASMEKMGRINVKTGSAGEIRKQCAVINS

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGTTTTGGTTCTTTAGGCATACTTGTCCTTGCAATTTTAGCATACATAGCCTCAACTCAAGCTCAGCTTCAGATTGGCTTCTATTCTCAAAGCTGTCCAAGAGCTGAGCAGATT
GTTCAAGATTTTGTCAACCAGCATATTCATAATGCTCCATCTCTTGCAGCTACTTTTATCAGAATGCACTTCCATGATTGTTTTGTCAGG
GTAAATTACTCTTTTGGTCCCTTCTCTTTC
AGTTTCTGGTTATAAAGTATTCACCAAGTTTATTGTATTGTGGTCTACTTTGCAGGGTTGTGATGCTTCTGTGCTTATAAACTCAACATCAAACAATCAAGCTGAAAAATCTGCAACTCC
AAATTTAACACTCAGAGGATTTGATTTCATTGACAGAGTCAAGAGCTTGCTTGAAGCAGAGTGCCCTGGTGTGGTCTCTTGTGCTGATACTATTGCTCTGGTTGCCAGAGACTCCATTGT
AGCTACT
GTAAGGATTAAGAATTACTCAAATTAATTTCCAAAATTAAATCCAACCCATTACAGGTTGTTCTGAATATCTTCCATTTCTGGGTTCAACAGGGTGGTCCTTCCTGGAATGTT
CCAACTGGAAGAAGAGATGGAACAATTTCAAATTCTTCAGAGGCCCTGGCGAACATCCCACCTCCGACCAGCAACTTCACCAATCTCCAGAGACTATTTGCTAATGTGGGTCTGGACCTG
AAAGACTTGGTGTTGCTTTCTGGTGCTCACACAATTGGAATAGCTCATTGTCCATCGTTTTCAAACCGCCTGTACAATTTCACAGGAGTTGGAGATCAGGATCCTGCTCTTGATAGCGAA
TATGCTGCAAATCTCAAGGCAAGGAAGTGTACAACGCCTAATGATAATACCACCATTGTTGAGATGGATCCTGGAAGTAGAAAAACATTTGATCTTAGCTATTACTCTAATTTGCTCAAG
AGAAGAGGACTTTTCCAATCAGATTCTGCATTGACCACAAACTCTGCAACATTGGCTACAATCAACCAGCTTCTCAGTGGTTCACTGCAGAATTTCTACTCTGAATTTGCTGCGTCCATG
GAGAAAATGGGTAGAATCAATGTCAAAACTGGCTCTGCTGGTGAGATTAGGAAGCAATGTGCAGTGATCAATAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGTTTTGGTTCTTTAGGCATACTTGTCCTTGCAATTTTAGCATACATAGCCTCAACTCAAGCTCAGCTTCAGATTGGCTTCTATTCTCAAAGCTGTCCAAGAGCTGAGCAGATT
GTTCAAGATTTTGTCAACCAGCATATTCATAATGCTCCATCTCTTGCAGCTACTTTTATCAGAATGCACTTCCATGATTGTTTTGTCAGG
GGTTGTGATGCTTCTGTGCTTATAAACTCA
ACATCAAACAATCAAGCTGAAAAATCTGCAACTCCAAATTTAACACTCAGAGGATTTGATTTCATTGACAGAGTCAAGAGCTTGCTTGAAGCAGAGTGCCCTGGTGTGGTCTCTTGTGCT
GATACTATTGCTCTGGTTGCCAGAGACTCCATTGTAGCTACT
GGTGGTCCTTCCTGGAATGTTCCAACTGGAAGAAGAGATGGAACAATTTCAAATTCTTCAGAGGCCCTGGCGAACATC
CCACCTCCGACCAGCAACTTCACCAATCTCCAGAGACTATTTGCTAATGTGGGTCTGGACCTGAAAGACTTGGTGTTGCTTTCTGGTGCTCACACAATTGGAATAGCTCATTGTCCATCG
TTTTCAAACCGCCTGTACAATTTCACAGGAGTTGGAGATCAGGATCCTGCTCTTGATAGCGAATATGCTGCAAATCTCAAGGCAAGGAAGTGTACAACGCCTAATGATAATACCACCATT
GTTGAGATGGATCCTGGAAGTAGAAAAACATTTGATCTTAGCTATTACTCTAATTTGCTCAAGAGAAGAGGACTTTTCCAATCAGATTCTGCATTGACCACAAACTCTGCAACATTGGCT
ACAATCAACCAGCTTCTCAGTGGTTCACTGCAGAATTTCTACTCTGAATTTGCTGCGTCCATGGAGAAAATGGGTAGAATCAATGTCAAAACTGGCTCTGCTGGTGAGATTAGGAAGCAA
TGTGCAGTGATCAATAGT

Retrieve as FASTA