Entry information : MePrx25 (cassava4.1_011775m)
Entry ID 9104
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-10 (Christophe Dunand)
Peroxidase information: MePrx25 (cassava4.1_011775m)
Name (synonym) MePrx25 (cassava4.1_011775m)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx25
start..stop
S start..stop
MePrx24 612 0 1..326 1..326
RcPrx71 574 0 4..326 1..324
QrobPrx01 546 0 1..318 1..318
PtPrx27 541 0 7..326 7..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 93364..93573 210 N° 2 93651..93842 192 N° 3 93936..94511 576  
join(93364..93573,93651..93842,93936..94511)


exon

Literature and cross-references MePrx25 (cassava4.1_011775m)
DNA ref. Phytozome 12:   scaffold04099 (93364..94511)
EST ref. GenBank:   DB937582.1 [5' end]
Protein sequence: MePrx25 (cassava4.1_011775m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (303)
PWM (Da):   %s   35273.71 (32840.5)  
PI (pH):   %s   6.76 (6.76) Peptide Signal:   %s   cut: 24 range:24-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKLSCFGILVFAFLAYIASTEAQLQMGFYSQSCPRAEQIVQDFVNQHIHNAPSLAATIIRMHFHDCFVRGCDGSVLINSTSNNQAEKAAIPNLTLRGFDFIDRVKSLLEEECPGVVSCADVIALVARDSIVATGGPSWRVPTGRRDGTISNASEALASIPAPTSNFTNLQRLFGNVGLDLKDLVLLSGAHTIGVAHCPAFSNRLYNFTGVGDQDPALDSEYAANLKARKCTTPNDNTTIVEMDPGSRKTFDLSYYSNLIKRRGLFRSDSVLTTNSDTLSIINQLLSGSLQYFFDEFAASMEKMGRINVKTGSAGEIRKLCSVVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGCTGAGTTGTTTTGGGATACTTGTCTTTGCATTTTTAGCTTATATAGCCTCAACTGAAGCTCAACTTCAAATGGGTTTTTATTCTCAAAGCTGCCCAAGAGCTGAGCAAATT
GTACAAGATTTTGTTAACCAGCACATCCATAATGCTCCATCACTTGCAGCTACCATCATTAGAATGCATTTCCATGATTGCTTTGTCAGG
GTAAATTAATCTCTCCATTGCTTGTTTCCC
TTTCTGTTTCTTGATCCAAGTTAATTATATTTTGGTTTAACTTTCAGGGTTGTGATGGGTCTGTGCTTATAAATTCAACATCAAACAATCAAGCTGAAAAAGCTGCAATTCCAAATCTAA
CTCTAAGAGGCTTTGATTTCATTGATAGAGTTAAGAGCTTGCTTGAAGAAGAGTGCCCTGGTGTAGTCTCCTGTGCAGATGTTATTGCTTTGGTTGCCAGGGACTCCATTGTTGCTACT
G
TAAGAGAACTACTCAAATCAGTTTCCAAAATTAACTCCAACCTATTAAAAATTTTTGTTGATTTTCTTGTTTTTGTTTCTGGGTTCCAACAGGGTGGTCCTTCCTGGAGAGTTCCAACGG
GAAGAAGAGATGGAACAATCTCAAATGCTTCAGAAGCCCTGGCAAGCATCCCAGCTCCGACGAGCAACTTCACCAATCTCCAGAGACTTTTTGGCAATGTGGGCCTGGACTTGAAAGACT
TGGTGTTGCTTTCAGGCGCACACACAATCGGAGTAGCTCATTGTCCAGCATTTTCAAATCGCCTGTACAATTTCACAGGCGTAGGAGATCAGGATCCTGCTCTGGATAGTGAATATGCAG
CAAATCTCAAGGCAAGGAAGTGCACAACTCCTAATGATAATACCACAATTGTTGAGATGGATCCTGGAAGTCGGAAAACTTTTGATCTCAGTTATTATTCTAATTTGATCAAGAGAAGAG
GACTTTTCCGATCAGATTCTGTCTTGACTACAAACTCTGATACGTTGAGTATAATCAACCAGCTGCTCAGTGGTTCACTGCAGTATTTCTTTGATGAATTTGCTGCTTCCATGGAGAAAA
TGGGTAGAATCAATGTCAAAACTGGCTCTGCTGGTGAGATTAGGAAGCTGTGTTCAGTGGTGAACAGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGCTGAGTTGTTTTGGGATACTTGTCTTTGCATTTTTAGCTTATATAGCCTCAACTGAAGCTCAACTTCAAATGGGTTTTTATTCTCAAAGCTGCCCAAGAGCTGAGCAAATT
GTACAAGATTTTGTTAACCAGCACATCCATAATGCTCCATCACTTGCAGCTACCATCATTAGAATGCATTTCCATGATTGCTTTGTCAGG
GGTTGTGATGGGTCTGTGCTTATAAATTCA
ACATCAAACAATCAAGCTGAAAAAGCTGCAATTCCAAATCTAACTCTAAGAGGCTTTGATTTCATTGATAGAGTTAAGAGCTTGCTTGAAGAAGAGTGCCCTGGTGTAGTCTCCTGTGCA
GATGTTATTGCTTTGGTTGCCAGGGACTCCATTGTTGCTACT
GGTGGTCCTTCCTGGAGAGTTCCAACGGGAAGAAGAGATGGAACAATCTCAAATGCTTCAGAAGCCCTGGCAAGCATC
CCAGCTCCGACGAGCAACTTCACCAATCTCCAGAGACTTTTTGGCAATGTGGGCCTGGACTTGAAAGACTTGGTGTTGCTTTCAGGCGCACACACAATCGGAGTAGCTCATTGTCCAGCA
TTTTCAAATCGCCTGTACAATTTCACAGGCGTAGGAGATCAGGATCCTGCTCTGGATAGTGAATATGCAGCAAATCTCAAGGCAAGGAAGTGCACAACTCCTAATGATAATACCACAATT
GTTGAGATGGATCCTGGAAGTCGGAAAACTTTTGATCTCAGTTATTATTCTAATTTGATCAAGAGAAGAGGACTTTTCCGATCAGATTCTGTCTTGACTACAAACTCTGATACGTTGAGT
ATAATCAACCAGCTGCTCAGTGGTTCACTGCAGTATTTCTTTGATGAATTTGCTGCTTCCATGGAGAAAATGGGTAGAATCAATGTCAAAACTGGCTCTGCTGGTGAGATTAGGAAGCTG
TGTTCAGTGGTGAACAGC

Retrieve as FASTA