Entry information : MePrx26 (cassava4.1_011778m)
Entry ID 9105
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx26 (cassava4.1_011778m)
Name (synonym) MePrx26 (cassava4.1_011778m)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx26
start..stop
S start..stop
MePrx27 570 0 1..326 1..326
RcPrx27 536 0 1..326 1..318
PatrPrx68 517 0 4..326 3..322
PtPrx68 515 0 4..326 3..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 100578..100808 231 N° 2 99989..100180 192 N° 3 99746..99911 166 N° 4 97898..98286 389
complement(join(97898..98286,99746..99911,99989..100180,100578..100808))


exon

Literature and cross-references MePrx26 (cassava4.1_011778m)
DNA ref. Phytozome 12:   scaffold10689 (100808..97898)
Protein sequence: MePrx26 (cassava4.1_011778m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (303)
PWM (Da):   %s   35206 (32637.6)  
PI (pH):   %s   9.7 (9.33) Peptide Signal:   %s   cut: 31 range:24-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSSVFFKALSRLLVFIPLTSIEITTTDSQLSTNFYSKSCPNLFSAVKPVVKSAINKEKRMGASLVRLFFHDCFVNGCDGSILLDDTSSFTGEKTAIPNRDSVRGFEVIDDIKSAVEKACPGVVSCADIVAIAARDSTVILGGPTWNVKLGRRDAKTASLSAANNGLPPATFNLNQLISIFNALGLSTRDLVALSGSHTVGQGRCISFRARIYNETNIDSGFAKTRRSKCPSTNGTGDNNLAPLDLQTPTRFDNKYFKNLLNQKGLLHSDQQLFNGGSTDSIVRTYSNSQSTFFSDFVTGMIKMGDISPLTGSKGEIRKNCRRV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTTCTTCAGTTTTTTTCAAGGCTCTTTCTCGTCTCCTTGTCTTCATCCCTCTGACTTCCATAGAAATCACCACTACCGATTCTCAACTTTCCACAAACTTCTACTCCAAATCT
TGCCCTAACCTCTTTTCTGCTGTGAAACCTGTTGTTAAATCCGCCATTAACAAAGAGAAACGAATGGGTGCTTCCCTCGTTCGCTTGTTCTTCCATGACTGCTTCGTCAAT
GTAATTCTT
TTCTCTTCTTTGCTTGTCATATAACTTAATTATGAGTTTGTTAAGTATTATTGTTGGAATTGTTTTCGAGTGAAATATCTTAAGGATATCNNNNNNNNNNNNNNNNNNNNNNCAACTCCT
CTGAAATCACTCTTTGATTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTCTATATAT
GATTGCTTGGTTTTATGTGATATGTGATAAGAAGTTTTCCATTGACAATTTTCTTCATCAAGTCATAAACTACTATAATTGGATCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGTAGCTTAATTTAAAATTTGATGACAGGGATGTGATGGTTCAATTCTACTCGACGACACATCTTCTTTCACCGGAGAGAAAACTGCAATTCCAAATCGGGATTCAGTCAGAGGATTTGA
AGTGATTGACGACATAAAATCTGCAGTTGAGAAGGCTTGCCCTGGTGTGGTCTCATGTGCTGACATTGTAGCCATTGCTGCTAGAGACTCCACTGTTATT
GTAAGAGTTTTCGTTTTTTT
CTATAGAAAATTTCAAGTTGTAATTAATTAATGAATTAATCATGGTAATTGATTTAGCTTGGAGGTCCAACTTGGAATGTCAAACTTGGAAGAAGAGATGCTAAAACGGCAAGCCTTTCT
GCTGCTAATAATGGCCTTCCACCTGCTACTTTTAACTTGAACCAACTCATTTCAATATTCAATGCTCTTGGCCTTTCAACCAGAGACTTGGTTGCATTATCTG
GTTAGCTCTCTCTCTCT
CTCAAATTCCTTTCGCATGAGCAACTGAACATACAACGAATCTCTTTTTTTTTTTTTCCAAACCAAAGATGGTTAATCTATGTTATTTTAATAATATGGGCTAGCTTATATCAACCTTTT
ATCATTTTTATAAATCCCATCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCACCTAAAAAATATTTAGTATGACACAGATGACTCAACTCATGATCAATACNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTCTTACAATGCAGTCTAACCGATTCAAATAACTTTTTTAATCGAAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGTTTATCAATTTAGTCTGGTAGTAAGTATATCTGAATAAATATGGAATATCTCAAGTTTTACTCCCTCAATTTCCNNNNNNNNNNNNNNNNNNNNNNGTTCTTGTAATTTA
AAAAAACTCACTCATTAATCAATCTCTCATATTTGTAAGAAATCTAATAATTATGATTTTTTTTACCGTACTTAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGTGACAGCAGGATCGCACACAGTTGGACAAGGAAGGTGTCGTTTAGGGCAAGAATAT
ATAATGAGACAAATATAGACAGTTGGTACTCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATCTTTCATGTTTGTAAGAAATTTAATAATT
ATGATTTTTTTTGCCATATTTAACAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATCTCTCATGTTGATAAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TTACAGGATTGCACACAGTTGGACAAAGAAGGTGTACATCGTTTAGGGCAAGTATATATAATGAGATAAATATAGACGGTCGGAAATCTCACAATTCTCAATCGCCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTTCTCATATTTATAAGAAGTCTAATATTTATGATTTCTTGTTACCGTATTTAATGACTAAAATTAATAGAGNNN
NNNNNNNNNNNNNNNNNNNNGATATCAGAAACGTTTTAATGTATTTTTTGAAGTTCAAAAACCAAATAATGAGTTTTGCCATAAAATATTATACAAGTTTTTAAAAAAAATTAGTGTTAC
AGGATCGCACACAGTTGGACAAGGAAGGTGCATATCGTTTAGGGCAAGAATATATAACGAGACAAACATAGACAGTGGGTTTGCTAAGACAAGGAGATCAAAGTGTCCAAGTACCAATGG
GACAGGAGACAACAACTTGGCACCACTTGATTTGCAGACTCCTACTCGTTTTGACAACAAGTACTTCAAGAACTTGCTTAATCAGAAGGGCCTCCTCCATTCTGATCAGCAATTGTTCAA
TGGTGGATCCACTGATTCCATAGTTCGCACCTACAGCAATTCCCAAAGCACTTTCTTCTCTGATTTTGTTACTGGCATGATCAAGATGGGAGATATCAGTCCACTTACTGGATCCAAAGG
AGAGATCAGGAAGAATTGTAGGAGGGTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTTCTTCAGTTTTTTTCAAGGCTCTTTCTCGTCTCCTTGTCTTCATCCCTCTGACTTCCATAGAAATCACCACTACCGATTCTCAACTTTCCACAAACTTCTACTCCAAATCT
TGCCCTAACCTCTTTTCTGCTGTGAAACCTGTTGTTAAATCCGCCATTAACAAAGAGAAACGAATGGGTGCTTCCCTCGTTCGCTTGTTCTTCCATGACTGCTTCGTCAAT
GGATGTGAT
GGTTCAATTCTACTCGACGACACATCTTCTTTCACCGGAGAGAAAACTGCAATTCCAAATCGGGATTCAGTCAGAGGATTTGAAGTGATTGACGACATAAAATCTGCAGTTGAGAAGGCT
TGCCCTGGTGTGGTCTCATGTGCTGACATTGTAGCCATTGCTGCTAGAGACTCCACTGTTATT
CTTGGAGGTCCAACTTGGAATGTCAAACTTGGAAGAAGAGATGCTAAAACGGCAAGC
CTTTCTGCTGCTAATAATGGCCTTCCACCTGCTACTTTTAACTTGAACCAACTCATTTCAATATTCAATGCTCTTGGCCTTTCAACCAGAGACTTGGTTGCATTATCTG
GATCGCACACA
GTTGGACAAGGAAGGTGCATATCGTTTAGGGCAAGAATATATAACGAGACAAACATAGACAGTGGGTTTGCTAAGACAAGGAGATCAAAGTGTCCAAGTACCAATGGGACAGGAGACAAC
AACTTGGCACCACTTGATTTGCAGACTCCTACTCGTTTTGACAACAAGTACTTCAAGAACTTGCTTAATCAGAAGGGCCTCCTCCATTCTGATCAGCAATTGTTCAATGGTGGATCCACT
GATTCCATAGTTCGCACCTACAGCAATTCCCAAAGCACTTTCTTCTCTGATTTTGTTACTGGCATGATCAAGATGGGAGATATCAGTCCACTTACTGGATCCAAAGGAGAGATCAGGAAG
AATTGTAGGAGGGTTAAT

Retrieve as FASTA