Entry information : MePrx27 (Manes.07G138600.1[6.1]/ cassava4.1_011779m)
Entry ID 9106
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-05 (Christophe Dunand)
Peroxidase information: MePrx27 (Manes.07G138600.1[6.1]/ cassava4.1_011779m)
Name (synonym) MePrx27 (Manes.07G138600.1[6.1]/ cassava4.1_011779m)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx27
start..stop
S start..stop
MePrx26 570 0 1..326 1..326
RcPrx27 570 0 1..326 1..318
PtPrx68 553 0 1..326 1..322
PbPrx68 553 0 1..326 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 99867..100097 231 N° 2 99484..99675 192 N° 3 99223..99388 166 N° 4 98657..99045 389
complement(join(98657..99045,99223..99388,99484..99675,99867..100097))


exon

Literature and cross-references MePrx27 (Manes.07G138600.1[6.1]/ cassava4.1_011779m)
DNA ref. Phytozome 12:   scaffold00926 (100097..98657)
Protein sequence: MePrx27 (Manes.07G138600.1[6.1]/ cassava4.1_011779m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (296)
PWM (Da):   %s   34976.57 (31801.0)  
PI (pH):   %s   9.39 (9.38) Peptide Signal:   %s   cut: 31 range:31-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSSFFKPIMSSCLLVLLLASMGITTTNAQLSTNFYSKSCPNLFSTVKPVVQSAINKEKRMGASLVRLFFHDCFVNGCDGSLLLDDTSSFTGEKTANPNRNSARGFDVIDNIKSAVEKACPGVVSCADILAIAARDSTAILGGPSWDVKLGRRDARTASLSAANNGIPPPTSNLNQLISRFNALGLSTRDLVALAGSHTIGQARCTSFRARIYNETNIDSSFAQTRRSNCPRTSGTGDNNLAPLDLLTPTSFDNNYFKNLVNQKGLLHSDQQLFNGGSTDSIVRTYSNGQSTFFSDFVAGMIKMGDISPLTGSRGEIRKNCRRV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTTCTTCTTTTTTCAAGCCTATTATGTCTTCTTGTCTCCTTGTTTTGCTTTTGGCTTCCATGGGAATCACCACTACCAATGCTCAACTCTCAACAAACTTCTACTCCAAATCT
TGCCCTAACCTCTTTTCTACTGTGAAACCTGTTGTTCAATCTGCCATTAATAAAGAGAAACGAATGGGTGCTTCCCTCGTTCGTTTGTTCTTCCATGATTGCTTTGTTAAT
GTAATTTTC
ATTCTCTTCATCATTTTTACATTAGTCAAGTTTTTCTTACTTAAACTCGGTCTATCAAAGATATTCATTTCTTACGTTTATAACGAATCCAACATATTCAAGGCCGTAATTCCATTGTGA
TAGGACCTCCCCTTTTTAACTATTTATATCAATATGATCATTTAATTTAAATTTCATGGCAGGGATGTGATGGCTCACTTCTACTTGACGACACTTCTTCCTTCACCGGAGAAAAGACTG
CAAATCCAAATCGGAATTCAGCAAGAGGATTTGATGTGATAGACAATATAAAATCCGCAGTTGAGAAAGCTTGTCCTGGAGTAGTCTCATGTGCTGATATCCTTGCCATCGCTGCTAGAG
ACTCTACTGCTATC
GTAAGTGATTTTTTTTTTTACACGTATGTAGCCTAATTCATGCATCATTTATTGAACTAATCATGGGTTTTTTTCTTCTGTTAATAATTAATTAGCTTGGAGGTCC
AAGTTGGGATGTTAAACTTGGAAGAAGAGATGCTAGAACTGCAAGCCTTTCTGCTGCAAATAATGGTATTCCTCCTCCAACTTCTAACCTCAACCAACTCATCTCAAGATTCAACGCTCT
CGGCCTTTCAACCAGAGACCTAGTTGCATTAGCGG
GTTAGTTTTATTTACATACATGCAATAAACGCGTAGTAAATATATGGAATTTCATGCAGCGCTACTATCATTTTATATTACGGGT
GTATAAAACTCGAACTAACTTCGGAGACTAAATTGTCATACATAAGCCAGCAGAGTTGCTGATGACTAAATCAAAAGCTGTAAATCTTACAGGATCGCACACAATTGGACAAGCAAGGTG
CACATCGTTTAGGGCAAGAATATACAATGAGACCAACATAGATAGTTCCTTTGCTCAGACAAGGAGATCAAACTGCCCAAGAACCAGTGGGACAGGGGACAACAACTTGGCACCACTTGA
TTTGCTGACTCCTACATCTTTTGATAACAACTACTTCAAGAACTTGGTTAATCAGAAGGGCCTCCTGCATTCCGATCAGCAATTGTTCAATGGTGGATCCACTGATTCAATAGTTCGCAC
CTACAGCAATGGCCAAAGCACCTTTTTCTCTGATTTTGTGGCTGGCATGATCAAGATGGGAGATATCAGTCCACTCACTGGATCACGAGGAGAGATCAGAAAAAATTGTAGGAGGGTGAA
C

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTTCTTCTTTTTTCAAGCCTATTATGTCTTCTTGTCTCCTTGTTTTGCTTTTGGCTTCCATGGGAATCACCACTACCAATGCTCAACTCTCAACAAACTTCTACTCCAAATCT
TGCCCTAACCTCTTTTCTACTGTGAAACCTGTTGTTCAATCTGCCATTAATAAAGAGAAACGAATGGGTGCTTCCCTCGTTCGTTTGTTCTTCCATGATTGCTTTGTTAAT
GGATGTGAT
GGCTCACTTCTACTTGACGACACTTCTTCCTTCACCGGAGAAAAGACTGCAAATCCAAATCGGAATTCAGCAAGAGGATTTGATGTGATAGACAATATAAAATCCGCAGTTGAGAAAGCT
TGTCCTGGAGTAGTCTCATGTGCTGATATCCTTGCCATCGCTGCTAGAGACTCTACTGCTATC
CTTGGAGGTCCAAGTTGGGATGTTAAACTTGGAAGAAGAGATGCTAGAACTGCAAGC
CTTTCTGCTGCAAATAATGGTATTCCTCCTCCAACTTCTAACCTCAACCAACTCATCTCAAGATTCAACGCTCTCGGCCTTTCAACCAGAGACCTAGTTGCATTAGCGG
GATCGCACACA
ATTGGACAAGCAAGGTGCACATCGTTTAGGGCAAGAATATACAATGAGACCAACATAGATAGTTCCTTTGCTCAGACAAGGAGATCAAACTGCCCAAGAACCAGTGGGACAGGGGACAAC
AACTTGGCACCACTTGATTTGCTGACTCCTACATCTTTTGATAACAACTACTTCAAGAACTTGGTTAATCAGAAGGGCCTCCTGCATTCCGATCAGCAATTGTTCAATGGTGGATCCACT
GATTCAATAGTTCGCACCTACAGCAATGGCCAAAGCACCTTTTTCTCTGATTTTGTGGCTGGCATGATCAAGATGGGAGATATCAGTCCACTCACTGGATCACGAGGAGAGATCAGAAAA
AATTGTAGGAGGGTGAAC

Retrieve as FASTA