Entry information : MePrx28 (cassava4.1_011787m)
Entry ID 9107
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx28 (cassava4.1_011787m)
Name (synonym) MePrx28 (cassava4.1_011787m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx28
start..stop
S start..stop
MePrx71 606 0 1..325 1..325
MePrx138 602 0 1..325 1..325
MePrx82 594 0 1..325 1..325
RcPrx36 584 0 1..325 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 465012..465245 234 N° 2 465353..465544 192 N° 3 465632..465797 166 N° 4 465877..466259 383
join(465012..465245,465353..465544,465632..465797,465877..466259)


exon

Literature and cross-references MePrx28 (cassava4.1_011787m)
DNA ref. Phytozome 12:   scaffold08799 (465012..466259)
Protein sequence: MePrx28 (cassava4.1_011787m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (294)
PWM (Da):   %s   34858.48 (31559.8) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.32 (8.20) Peptide Signal:   %s   cut: 32 range:32-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSISVLNISISPAKAAVFLFMVMLFNTACQAQLTSMFYDNSCPNALSTIRTSIRNSIAAERRMAASLVRLHFHDCFVQGCDASILLDETSSIESEKTAIPNKDSIRGFQVIDKAKSEVEKICPGVVSCADIIAVAARDASAYVGGPSWTVMLGRRDSTTASRTLANNELPSFKDGLDRLISRFQSKGLSARDMVALSGAHTIGQAQCFTFRDRIYGNISIDAGFASTRKRTCPAVGGDTNLAPFDLVTPNSFDNNYFKNLIQKKGLLESDQVLFSGGSTDSIVSEYSRSPAAFNSDFASAMIRMGNVNPLTGTAGQIRKICSAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAATTTCAGTTCTTAACATTTCAATATCTCCTGCAAAAGCTGCAGTGTTCTTGTTTATGGTGATGCTGTTTAATACTGCATGCCAAGCTCAGCTCACCTCTATGTTTTATGACAAT
TCTTGTCCAAATGCACTCAGTACTATCAGAACTTCCATCAGAAATTCAATTGCTGCAGAACGGAGAATGGCAGCTTCTCTCGTTCGTCTTCACTTTCATGATTGCTTCGTTCAG
GTATAC
TTAACCAACAATCAAATGCTTGGTTTTCTTCTCTTATATATATAACATGTACCTGCAAATCCATGTGAGAAGTATCTAAAGCATCGTAATTGGTTTTTCAGGGTTGTGATGCTTCAATCT
TGCTTGACGAGACTTCATCTATTGAGAGTGAAAAGACTGCAATTCCAAATAAGGATTCTATAAGAGGTTTTCAAGTCATTGACAAGGCAAAATCTGAAGTAGAAAAGATATGCCCTGGAG
TTGTATCTTGTGCAGATATAATTGCTGTGGCAGCAAGAGACGCATCTGCATAT
GTAAGCATATATATTCAATATATATTCTTTTCATGTTATATCCTATTACAGCATCATGATAAATATA
TTTTTGGAAAAAAAAATTAGGTTGGAGGTCCATCCTGGACAGTGATGCTTGGAAGAAGAGACTCGACTACTGCGAGCAGAACTCTAGCAAACAATGAACTGCCAAGCTTTAAAGATGGCC
TGGACAGACTTATATCTCGCTTTCAGAGTAAAGGCCTTAGCGCAAGGGACATGGTTGCCTTGTCAG
GTACCCCCATATACATTTTTATATATAGATAAACTTGAGCTCAAGGGCTTAGAG
ACTAATTGTTAATTTGCAACTGCAGGTGCTCATACCATTGGTCAAGCTCAATGCTTTACATTTCGTGATAGGATATATGGTAATATTTCCATAGACGCTGGATTTGCAAGCACTCGCAAG
CGTACTTGTCCAGCTGTTGGTGGTGATACAAACTTGGCTCCCTTTGATTTGGTGACACCAAATTCTTTCGACAACAACTACTTCAAGAATCTTATACAAAAGAAAGGTCTTCTTGAATCT
GATCAAGTTCTTTTTAGTGGAGGTTCTACAGACAGCATTGTCTCAGAATATAGCAGGAGTCCTGCAGCCTTCAACTCCGATTTTGCATCTGCCATGATTAGAATGGGAAATGTCAATCCT
CTCACTGGTACTGCTGGGCAGATAAGGAAGATTTGCAGTGCTGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAATTTCAGTTCTTAACATTTCAATATCTCCTGCAAAAGCTGCAGTGTTCTTGTTTATGGTGATGCTGTTTAATACTGCATGCCAAGCTCAGCTCACCTCTATGTTTTATGACAAT
TCTTGTCCAAATGCACTCAGTACTATCAGAACTTCCATCAGAAATTCAATTGCTGCAGAACGGAGAATGGCAGCTTCTCTCGTTCGTCTTCACTTTCATGATTGCTTCGTTCAG
GGTTGT
GATGCTTCAATCTTGCTTGACGAGACTTCATCTATTGAGAGTGAAAAGACTGCAATTCCAAATAAGGATTCTATAAGAGGTTTTCAAGTCATTGACAAGGCAAAATCTGAAGTAGAAAAG
ATATGCCCTGGAGTTGTATCTTGTGCAGATATAATTGCTGTGGCAGCAAGAGACGCATCTGCATAT
GTTGGAGGTCCATCCTGGACAGTGATGCTTGGAAGAAGAGACTCGACTACTGCG
AGCAGAACTCTAGCAAACAATGAACTGCCAAGCTTTAAAGATGGCCTGGACAGACTTATATCTCGCTTTCAGAGTAAAGGCCTTAGCGCAAGGGACATGGTTGCCTTGTCAG
GTGCTCAT
ACCATTGGTCAAGCTCAATGCTTTACATTTCGTGATAGGATATATGGTAATATTTCCATAGACGCTGGATTTGCAAGCACTCGCAAGCGTACTTGTCCAGCTGTTGGTGGTGATACAAAC
TTGGCTCCCTTTGATTTGGTGACACCAAATTCTTTCGACAACAACTACTTCAAGAATCTTATACAAAAGAAAGGTCTTCTTGAATCTGATCAAGTTCTTTTTAGTGGAGGTTCTACAGAC
AGCATTGTCTCAGAATATAGCAGGAGTCCTGCAGCCTTCAACTCCGATTTTGCATCTGCCATGATTAGAATGGGAAATGTCAATCCTCTCACTGGTACTGCTGGGCAGATAAGGAAGATT
TGCAGTGCTGTGAAC

Retrieve as FASTA