Entry information : MePrx34 (cassava4.1_012064m)
Entry ID 9113
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx34 (cassava4.1_012064m)
Name (synonym) MePrx34 (cassava4.1_012064m)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx34
start..stop
S start..stop
PtrePrx01 620 0 1..317 1..317
PtremPrx01 620 0 1..317 1..317
PtralPrx01 619 0 1..317 1..317
PtPrx02 616 0 1..317 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7734..7964 231 N° 2 8042..8230 189 N° 3 8637..8802 166 N° 4 8895..9260 366
N° 5 9321..9322 2  
join(7734..7964,8042..8230,8637..8802,8895..9260,9321..9322)


exon

Literature and cross-references MePrx34 (cassava4.1_012064m)
DNA ref. Phytozome 12:   scaffold00455 (7734..9322)
Protein sequence: MePrx34 (cassava4.1_012064m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (294)
PWM (Da):   %s   35862.39 (33291.0)  
PI (pH):   %s   7.52 (7.23) Peptide Signal:   %s   cut: 25 range:25-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDAKAFFLFALLSLSAVSLRTAFAEDEKDPGLIMNFYKDTCPQTEDIIREQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRTLSEKETDRSFGLRNFRYLDAIKEAVERECPGVVSCADILVLSARDGIVSLGGPYIPLKTGRRDGRNSRADVVEQYLPDHNESISVVLERFAAMGIDTPGVVSLLGAHSVGRTHCVKLVHRLYPEVDPVLNPDHVEHMLYKCPDSIPDPKAVQYVRNDRGTPMILDNNYYRNILDNKGLLTVDHQLATDKRTKPYVKKMAKSQDYFFKEFARAITILSENNPLTGTK

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGCCAAAGCTTTCTTCCTATTTGCTTTATTATCTCTCTCAGCTGTGTCTCTGAGGACAGCTTTTGCGGAAGATGAGAAAGACCCAGGTCTTATTATGAACTTCTACAAGGACACG
TGCCCTCAAACTGAAGATATTATCAGAGAACAAGTAAAGCTTCTGTACAAGAGACACAAGAACACTGCATTTTCATGGCTCAGAAACATCTTTCATGACTGTGCTGTTCAG
GTTAAAATT
CTCTCATCGCTTTTTCTTCTCTTTCCCTTCACTTCTTTTTAGTTTATGATGTATGTCTTTATTTTTAGTCGTGCGATGCTTCACTGCTGCTGGACTCAACCCGGAGGACCTTGTCTGAGA
AGGAGACGGACAGGAGCTTTGGCCTAAGGAACTTTAGATACCTTGATGCAATCAAAGAAGCTGTAGAGAGGGAATGTCCTGGAGTAGTTTCCTGTGCAGACATCCTTGTGCTGTCTGCTA
GAGATGGCATTGTTTCG
GTACTCCCATGGCCTTTTAGCCATGTCTTTGTTTCTGTTAAGAGTTTCTTTTTTGGAAGTACATCTGGAAATGGGCATGAATTTTAGATAAGCTAGAAATTTT
CACCCCAACTGCACGCAATTAATTATTTTGTCTCCAGTTTGAGTAAAGTTTCGGTTCAAGTTCTTGACGACAGATTTATATTGGGTTTCAAGACTGCATTTTTGAAAACATCTGTGCTCT
TAATTTTCTTCCCTTTATCTGAAACTACTTGATTTTAAGGTTTTTCCCCCCTGTTTTCCCTTATAAAGAAGAATTTCAACATTGGAGTATGGAGAGTTGCTACTACAACTATCTTATTTA
GTATAATTAATGACAATGGCAGCTTACAGCTTTAATGTGAGCTTAAAACTTTGCTGTTTTCAGCTAGGAGGTCCTTACATCCCTCTAAAAACTGGAAGAAGAGATGGAAGGAATAGCAGA
GCAGATGTGGTCGAGCAGTATCTCCCGGACCATAATGAGAGCATCTCTGTCGTTCTAGAGAGGTTTGCTGCCATGGGTATTGACACCCCTGGAGTGGTTTCCTTGCTAG
GTATGTGCCCT
GGTACATGCAAAAGGACACCAATCCAAGTGGCTTACTTAAGCATTAAAGTTCTTTTCTTTTTTCCCTTTATTTTCCTACAGGAGCTCACAGTGTTGGTAGAACACACTGTGTGAAGCTTG
TGCATCGTCTCTACCCGGAGGTAGATCCAGTGCTAAACCCTGACCATGTTGAGCACATGCTCTATAAGTGCCCTGACTCAATCCCAGACCCTAAGGCTGTGCAATACGTGAGAAATGACC
GTGGCACACCCATGATACTAGACAACAACTACTATAGAAATATATTGGACAACAAGGGCTTGTTGACAGTGGATCATCAACTAGCCACAGACAAGAGGACAAAGCCTTACGTGAAGAAAA
TGGCCAAAAGCCAGGACTACTTCTTTAAGGAATTTGCTAGGGCTATCACCATTCTGTCTGAGAATAACCCACTCACTGGTACCAAAG
GTGAGATCAGAAAACAGTGCAAGAGCTCAACTT
TTCTTCTCTCTTTATGTGAGGAAGAAGAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGCCAAAGCTTTCTTCCTATTTGCTTTATTATCTCTCTCAGCTGTGTCTCTGAGGACAGCTTTTGCGGAAGATGAGAAAGACCCAGGTCTTATTATGAACTTCTACAAGGACACG
TGCCCTCAAACTGAAGATATTATCAGAGAACAAGTAAAGCTTCTGTACAAGAGACACAAGAACACTGCATTTTCATGGCTCAGAAACATCTTTCATGACTGTGCTGTTCAG
TCGTGCGAT
GCTTCACTGCTGCTGGACTCAACCCGGAGGACCTTGTCTGAGAAGGAGACGGACAGGAGCTTTGGCCTAAGGAACTTTAGATACCTTGATGCAATCAAAGAAGCTGTAGAGAGGGAATGT
CCTGGAGTAGTTTCCTGTGCAGACATCCTTGTGCTGTCTGCTAGAGATGGCATTGTTTCG
CTAGGAGGTCCTTACATCCCTCTAAAAACTGGAAGAAGAGATGGAAGGAATAGCAGAGCA
GATGTGGTCGAGCAGTATCTCCCGGACCATAATGAGAGCATCTCTGTCGTTCTAGAGAGGTTTGCTGCCATGGGTATTGACACCCCTGGAGTGGTTTCCTTGCTAG
GAGCTCACAGTGTT
GGTAGAACACACTGTGTGAAGCTTGTGCATCGTCTCTACCCGGAGGTAGATCCAGTGCTAAACCCTGACCATGTTGAGCACATGCTCTATAAGTGCCCTGACTCAATCCCAGACCCTAAG
GCTGTGCAATACGTGAGAAATGACCGTGGCACACCCATGATACTAGACAACAACTACTATAGAAATATATTGGACAACAAGGGCTTGTTGACAGTGGATCATCAACTAGCCACAGACAAG
AGGACAAAGCCTTACGTGAAGAAAATGGCCAAAAGCCAGGACTACTTCTTTAAGGAATTTGCTAGGGCTATCACCATTCTGTCTGAGAATAACCCACTCACTGGTACCAAAG
AG

Retrieve as FASTA