Entry information : MePrx53(Manes.08G043700 / cassava4.1_015974m)
Entry ID 9115
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-08-22 (Christophe Dunand)
Peroxidase information: MePrx53(Manes.08G043700 / cassava4.1_015974m)
Name MePrx53(Manes.08G043700 / cassava4.1_015974m)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx53
start..stop
S start..stop
RcPrx16 557 0 3..334 5..335
PpePrx07 546 0 14..333 11..332
PtPrx72 537 0 4..334 2..331
PbPrx72 537 0 4..334 2..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68493..68720 228 N° 2 68809..69000 192 N° 3 69139..69304 166 N° 4 69385..69800 416
join(68493..68720,68809..69000,69139..69304,69385..69800)


exon

Literature and cross-references MePrx53(Manes.08G043700 / cassava4.1_015974m)
DNA ref. Phytozome 12:   scaffold00823 (68493..69800)
Protein sequence: MePrx53(Manes.08G043700 / cassava4.1_015974m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (305)
PWM (Da):   %s   34824.2 (31817.5)  
PI (pH):   %s   5.61 (4.60) Peptide Signal:   %s   cut: 30 range:30-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSSKTTSASSMVLPIVLAALLLVHKSNAQLSSTFYATTCSNVSAIVTSVVQQALQSDPRIGASLIRLHFHDCFVNGCDASLLLDNSSTILSEKFAAPNVNSARGFDVVDNIKTAVENSCPGVVSCADILALAAEASVSLSGGQSWSVLLGRRDSLTANQAGANTSIPSPFEGLNNITSKFSAVGLNTNDLVALSGAHTFGRAQCRTFSNRLFNFSGTGSPDPTLNATYLTTLQQLCPQGGSGATLANLDPTTPDNFDNNYFTNLQNNQGLLQSDQELFSTAGAATVSIVNSFSSSQTAFFQSFAQSMINMGNISPLTGTNGEIRADCKKVNG

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTTCTTCTAAAACGACAAGTGCTAGTTCTATGGTGCTGCCAATTGTTTTGGCAGCACTACTACTGGTGCACAAATCTAATGCTCAATTAAGTTCTACGTTCTATGCTACAACATGC
TCTAATGTTTCTGCCATTGTTACTAGTGTTGTTCAACAAGCCCTTCAATCCGATCCCCGGATCGGCGCCAGCCTCATTCGCCTTCATTTTCATGATTGCTTTGTCAAT
GTAAATCCAATC
CAATTTCTACGAACTAGCTAGATTCCCAGATTTAAATTAAACTAACGTTTTTTTCTTTTTTTGAAATTGGTAACAGGGATGCGATGCTTCACTTTTGCTAGACAATAGTTCAACCATACT
GAGCGAGAAATTTGCAGCTCCAAACGTTAACTCCGCTCGGGGTTTTGATGTCGTTGACAATATCAAAACTGCCGTCGAAAATTCTTGCCCTGGTGTTGTCTCTTGCGCTGATATTCTCGC
ACTCGCAGCTGAAGCTTCTGTTTCTCTT
GTAAGTCATATATCAATCTCCGCCGAAACCTTACAGCTCATGTTATTACTTAGCAAGAGTTTAGTGGCGTGTATAAGTTTTTCTGCAATACA
TAAATGAAAATTTTCCTAGAATGAAAATGAGCTTTGATGCTTCCAGTCAGGAGGACAATCGTGGAGTGTTCTGCTGGGAAGAAGAGATAGTCTCACAGCAAATCAGGCTGGAGCAAATAC
ATCGATTCCTTCTCCTTTTGAAGGTCTAAACAACATTACTTCCAAATTCTCTGCAGTGGGTCTGAACACTAATGATCTTGTGGCATTATCAG
GTGATTCCCGTGAAAAAACTTGGTTTAA
ATCCTTAAGAAAATTCTATCCTGAAATGGGATTTTGAATCTGAAATTTGCAGGAGCTCACACATTTGGACGTGCTCAATGTCGAACATTCAGCAACAGGCTGTTCAATTTCAGCGGCACA
GGCAGCCCAGACCCAACATTGAACGCAACTTACTTAACTACGCTGCAACAGTTATGTCCACAGGGTGGCAGTGGAGCGACTCTGGCGAACCTTGATCCGACGACGCCGGATAATTTTGAC
AATAACTATTTCACAAACCTGCAGAACAATCAGGGGCTTCTGCAATCTGATCAGGAGCTGTTTTCGACGGCAGGGGCTGCGACGGTCTCCATTGTTAACAGCTTTAGCAGTAGCCAAACT
GCTTTCTTCCAGAGCTTTGCTCAGTCCATGATTAATATGGGAAACATTAGTCCATTAACTGGAACTAATGGGGAGATTAGAGCAGATTGTAAGAAGGTGAATGGAAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTTCTTCTAAAACGACAAGTGCTAGTTCTATGGTGCTGCCAATTGTTTTGGCAGCACTACTACTGGTGCACAAATCTAATGCTCAATTAAGTTCTACGTTCTATGCTACAACATGC
TCTAATGTTTCTGCCATTGTTACTAGTGTTGTTCAACAAGCCCTTCAATCCGATCCCCGGATCGGCGCCAGCCTCATTCGCCTTCATTTTCATGATTGCTTTGTCAAT
GGATGCGATGCT
TCACTTTTGCTAGACAATAGTTCAACCATACTGAGCGAGAAATTTGCAGCTCCAAACGTTAACTCCGCTCGGGGTTTTGATGTCGTTGACAATATCAAAACTGCCGTCGAAAATTCTTGC
CCTGGTGTTGTCTCTTGCGCTGATATTCTCGCACTCGCAGCTGAAGCTTCTGTTTCTCTT
TCAGGAGGACAATCGTGGAGTGTTCTGCTGGGAAGAAGAGATAGTCTCACAGCAAATCAG
GCTGGAGCAAATACATCGATTCCTTCTCCTTTTGAAGGTCTAAACAACATTACTTCCAAATTCTCTGCAGTGGGTCTGAACACTAATGATCTTGTGGCATTATCAG
GAGCTCACACATTT
GGACGTGCTCAATGTCGAACATTCAGCAACAGGCTGTTCAATTTCAGCGGCACAGGCAGCCCAGACCCAACATTGAACGCAACTTACTTAACTACGCTGCAACAGTTATGTCCACAGGGT
GGCAGTGGAGCGACTCTGGCGAACCTTGATCCGACGACGCCGGATAATTTTGACAATAACTATTTCACAAACCTGCAGAACAATCAGGGGCTTCTGCAATCTGATCAGGAGCTGTTTTCG
ACGGCAGGGGCTGCGACGGTCTCCATTGTTAACAGCTTTAGCAGTAGCCAAACTGCTTTCTTCCAGAGCTTTGCTCAGTCCATGATTAATATGGGAAACATTAGTCCATTAACTGGAACT
AATGGGGAGATTAGAGCAGATTGTAAGAAGGTGAATGGAAGT

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACTAGC CAAAAATTAG AAACCACTAA TTTGAAGGCT TTTGATTTTG CTGAAAGAAA CGACAATGCG TTCTTCTAAA ACGACAAGTG CTAGTTCTAT GGTGCTGCCA ATTGTTTTGG  CAGCACTACT ACTGGTGCAC AAATCTAATG CTCAATTAAG TTCTACGTTC TATGCTACAA CATGCTCTAA TGTTTCTGCC ATTGTTACTA GTGTTGTTCA ACAAGCCCTT CAATCCGATC  CCCGGATCGG CGCCAGCCTC ATTCGCCTTC ATTTTCATGA TTGCTTTGTC AATGGATGCG ATGCTTCACT TTTGCTAGAC AATAGTTCAA CCATACTGAG CGAGAAATTT GCAGCTCCAA  ACGTTAACTC CGCTCGGGGT TTTGATGTCG TTGACAATAT CAAAACTGCC GTCGAAAATT CTTGCCCTGG TGTTGTCTCT TGCGCTGATA TTCTCGCACT CGCAGCTGAA GCTTCTGTTT  CTCTTTCAGG AGGACAATCG TGGAGTGTTC TGCTGGGAAG AAGAGATAGT CTCACAGCAA ATCAGGCTGG AGCAAATACA TCGATTCCTT CTCCTTTTGA AGGTCTAAAC AACATTACTT  CCAAATTCTC TGCAGTGGGT CTGAACACTA ATGATCTTGT GGCATTATCA GGAGCTCACA CATTTGGACG TGCTCAATGT CGAACATTCA GCAACAGGCT GTTCAATTTC AGCGGCACAG  GCAGCCCAGA CCCAACATTG AACGCAACTT ACTTAACTAC GCTGCAACAG TTATGTCCAC AGGGTGGCAG TGGAGCGACT CTGGCGAACC TTGATCCGAC GACGCCGGAT AATTTTGACA  ATAACTATTT CACAAACCTG CAGAACAATC AGGGGCTTCT GCAATCTGAT CAGGAGCTGT TTTCGACGGC AGGGGCTGCG ACGGTCTCCA TTGTTAACAG CTTTAGCAGT AGCCAAACTG  CTTTCTTCCA GAGCTTTGCT CAGTCCATGA TTAATATGGG AAACATTAGT CCATTAACTG GAACTAATGG GGAGATTAGA GCAGATTGTA AGAAGGTGAA TGGAAGTTAG GCTGTGGGGT  TGATTGTCAC ATCATGACAA GTTCAGGGTC CTTTTTCTAA ATAAAAAAAA TCTGAGGTAT TTAAAAGAAG ATTATAAGGA GATGTTTTAT GATTTTAAAG GGTGAAGTAG GACTAAGATT 
TAGATATGGA GGTGCTGCCA ATGCAATTTG TAAAAGTATT GTGAAAGTTT GTATTAGATT TGTTTCGTAT TTATTTATTA AAGCCTTGTG GATTAGTTC 

Retrieve as FASTA