Entry information : MePrx58 (cassava4.1_021696m)
Entry ID 9118
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx58 (cassava4.1_021696m)
Name (synonym) MePrx58 (cassava4.1_021696m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx58
start..stop
S start..stop
RcPrx36 578 0 1..328 1..326
MePrx28 577 0 1..328 1..325
MePrx138 570 0 1..328 1..325
MePrx71 567 0 1..328 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 261352..261591 240 N° 2 261724..261915 192 N° 3 261999..262550 552  
join(261352..261591,261724..261915,261999..262550)


exon

Literature and cross-references MePrx58 (cassava4.1_021696m)
DNA ref. Phytozome 12:   scaffold10173 (261352..262550)
Protein sequence: MePrx58 (cassava4.1_021696m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (295)
PWM (Da):   %s   34849.54 (31443.7)  
PI (pH):   %s   7.62 (7.25) Peptide Signal:   %s   cut: 34 range:34-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVQVLNILASPAKAAAFMLVVLLLNTACHCQAQLTSTFYETSCPNALGTIRTSIRNSIAAERRMAASLVRLHFHDCFVQGCDASILLDETPSVESEKTALPNKDSARGFQVIEKAKAEVEKICPGVVSCADVVAVAARDASAYVGGPSWTVMLGRRDSTTASRTLANSELPSFKASLDSLISSFQKKGLSARDMVALSGSHTLGQAQCFTFRDRIYSNGSDIDAGFASTRKRSCPEVGGDSNLAPLDLVTPNAFDNTYFKNLIQRKGLLESDQILFSGGSTDSIVSEYSRIPATFSSDFASAMIKMGNINPLTGTAGEIRKICNAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTTCAAGTTCTTAACATTTTAGCATCTCCTGCGAAAGCTGCAGCTTTCATGTTAGTAGTGCTGCTTTTGAACACTGCGTGCCATTGTCAGGCTCAACTCACCTCCACATTTTAT
GAAACTTCTTGTCCAAATGCACTCGGCACTATACGAACTTCCATAAGGAATTCAATTGCAGCAGAACGAAGAATGGCAGCTTCTCTCGTTCGTCTGCACTTCCATGATTGCTTTGTTCAG
GTATATATACACAGTCCAGTGTAACTAATAACAATAGATCATCTGTGCTGGATAATTATTCTTCTCTCATTTAAGATGCAATCGCTCTAAGTATGTGCAGTATTTTCATGAATCCTAATT
GGTTTTTTGTAGGGTTGTGATGCCTCAATCTTGCTTGATGAGACACCATCTGTCGAGAGTGAAAAGACTGCGCTGCCTAACAAGGATTCTGCAAGAGGTTTTCAAGTCATCGAGAAAGCA
AAAGCTGAAGTAGAGAAGATATGCCCCGGTGTTGTATCCTGTGCAGATGTAGTCGCTGTGGCTGCAAGGGATGCATCTGCATAT
GTAAGTATACTTCATTCAGCTGCCATTCTTCTCAAG
TTCTAGTTTTCATTTTTTTGACATTCTTTTTATACAAAAATTATCAGGTGGGTGGTCCATCTTGGACAGTGATGCTTGGAAGAAGAGACTCAACTACTGCAAGTCGAACTCTAGCAAATA
GTGAACTGCCAAGCTTTAAAGCTAGCCTGGACAGCCTCATATCTAGCTTTCAAAAGAAAGGGCTTAGTGCAAGGGATATGGTTGCCTTGTCAGGTTCTCATACTCTAGGCCAAGCTCAAT
GCTTCACATTTCGTGACAGGATATATAGCAATGGCAGCGACATTGATGCTGGATTTGCAAGCACTCGCAAGCGCAGTTGCCCTGAAGTTGGCGGTGATTCAAATTTGGCTCCACTTGATT
TGGTCACACCCAATGCTTTTGACAACACTTACTTCAAGAATCTCATACAGAGGAAAGGTCTTCTTGAATCTGATCAAATTCTTTTCAGTGGAGGTTCCACAGACAGTATTGTTTCAGAAT
ATAGCAGGATTCCTGCGACTTTCAGCTCCGATTTTGCATCTGCCATGATCAAAATGGGAAATATCAATCCACTGACTGGAACTGCAGGTGAAATTAGAAAAATCTGCAATGCTGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTTCAAGTTCTTAACATTTTAGCATCTCCTGCGAAAGCTGCAGCTTTCATGTTAGTAGTGCTGCTTTTGAACACTGCGTGCCATTGTCAGGCTCAACTCACCTCCACATTTTAT
GAAACTTCTTGTCCAAATGCACTCGGCACTATACGAACTTCCATAAGGAATTCAATTGCAGCAGAACGAAGAATGGCAGCTTCTCTCGTTCGTCTGCACTTCCATGATTGCTTTGTTCAG
GGTTGTGATGCCTCAATCTTGCTTGATGAGACACCATCTGTCGAGAGTGAAAAGACTGCGCTGCCTAACAAGGATTCTGCAAGAGGTTTTCAAGTCATCGAGAAAGCAAAAGCTGAAGTA
GAGAAGATATGCCCCGGTGTTGTATCCTGTGCAGATGTAGTCGCTGTGGCTGCAAGGGATGCATCTGCATAT
GTGGGTGGTCCATCTTGGACAGTGATGCTTGGAAGAAGAGACTCAACT
ACTGCAAGTCGAACTCTAGCAAATAGTGAACTGCCAAGCTTTAAAGCTAGCCTGGACAGCCTCATATCTAGCTTTCAAAAGAAAGGGCTTAGTGCAAGGGATATGGTTGCCTTGTCAGGT
TCTCATACTCTAGGCCAAGCTCAATGCTTCACATTTCGTGACAGGATATATAGCAATGGCAGCGACATTGATGCTGGATTTGCAAGCACTCGCAAGCGCAGTTGCCCTGAAGTTGGCGGT
GATTCAAATTTGGCTCCACTTGATTTGGTCACACCCAATGCTTTTGACAACACTTACTTCAAGAATCTCATACAGAGGAAAGGTCTTCTTGAATCTGATCAAATTCTTTTCAGTGGAGGT
TCCACAGACAGTATTGTTTCAGAATATAGCAGGATTCCTGCGACTTTCAGCTCCGATTTTGCATCTGCCATGATCAAAATGGGAAATATCAATCCACTGACTGGAACTGCAGGTGAAATT
AGAAAAATCTGCAATGCTGTCAAC

Retrieve as FASTA