Entry information : MePrx69 (cassava4.1_023324m)
Entry ID 9126
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx69 (cassava4.1_023324m)
Name (synonym) MePrx69 (cassava4.1_023324m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx69
start..stop
S start..stop
MePrx67 640 0 1..322 1..323
MePrx76 634 0 1..322 1..323
MePrx28 513 0 1..322 1..325
RcPrx36 512 0 1..322 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 246968..247189 222 N° 2 247265..247456 192 N° 3 247546..247711 166 N° 4 247808..248193 386
join(246968..247189,247265..247456,247546..247711,247808..248193)


exon

Literature and cross-references MePrx69 (cassava4.1_023324m)
DNA ref. Phytozome 12:   scaffold10173 (246968..248193)
Protein sequence: MePrx69 (cassava4.1_023324m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (295)
PWM (Da):   %s   35013.97 (32082.5)  
PI (pH):   %s   9.9 (9.91) Peptide Signal:   %s   cut: 28 range:28-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATSIRKISGAVMFMVMFLVLNTSCEAKLNSKYYEKSCPKALSTIRSTIRTAIARERRMAASLIRLHFHDCFVQGCDGSILLDETSSIKSEKTALPNLNSARGFEVIEKAKSQVEKICPGVVSCADIIAVAARDATEYVAGPSYTVLLGRRDSTTASRDRANKELPSFRDGLDKLISRFQKIGLNARDLVALSGSHTLGQAQCATFRDRIYSNGSDIDAGFATTRRRRCPAVGGDGNLAPLDLVTPNSWDSNYFKNLIQKKGLLESDQVLFSGGSTDSIVREYSKNRAAFNADFASAMIKMGNYKPLTGSKGQIRRICSAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACCTCTATTCGAAAAATCTCAGGAGCTGTCATGTTTATGGTCATGTTTCTGGTGTTGAACACATCATGCGAGGCTAAACTCAACTCTAAGTATTATGAGAAATCATGTCCAAAA
GCTCTCAGTACTATCAGAAGTACCATCAGGACGGCTATTGCACGAGAACGAAGAATGGCTGCATCTCTCATTCGTCTACACTTTCATGATTGTTTTGTCCAG
GTACTTAATCTTGATTTT
TACTTATAATCCAAAATATTCGTGTTTTGTTGAAAATTAAATCATCTTCTTTTGCAGGGTTGTGATGGCTCAATCCTACTGGATGAGACTTCCTCTATCAAGAGTGAGAAGACTGCATTG
CCCAACTTAAATTCTGCTAGAGGTTTTGAAGTCATTGAAAAGGCAAAATCTCAAGTAGAGAAGATATGCCCAGGTGTTGTATCCTGTGCAGATATCATTGCTGTGGCTGCAAGGGATGCT
ACTGAATAT
GTAAGTAACCCCCGGTATGTCTTCTCAATTCATGTCTATCGATAAAACCCAGGAGCCAGAACTAATGTTTATACATTTTCAAATCTCAGGTGGCTGGTCCATCTTACACTG
TTTTGCTCGGAAGAAGAGATTCAACTACTGCAAGCAGAGATCGAGCCAACAAAGAACTTCCTAGTTTTAGAGATGGTCTGGACAAACTTATATCTCGTTTTCAGAAAATAGGACTCAATG
CTAGGGACTTGGTTGCTTTGTCAG
GTTCTAAACCATTCCACTTAATTAATTAAACTCATTAATAATTAACGAAACACTTGNNNNNNNNNNNNNNNNNNNNNNCCATTTCTCCAAATGCAG

GTTCTCACACTCTAGGACAAGCGCAGTGTGCTACCTTTCGTGACAGGATATACAGCAATGGCAGCGACATTGATGCTGGATTTGCTACCACTCGCCGGCGTCGTTGTCCTGCTGTTGGTG
GCGACGGAAATCTGGCTCCACTTGATTTGGTCACACCCAATTCATGGGACAGCAATTACTTCAAGAATTTGATCCAAAAGAAAGGTCTTTTAGAATCAGATCAAGTACTCTTCAGTGGAG
GTTCCACCGACAGTATTGTCCGAGAATATAGCAAGAATCGTGCAGCTTTCAACGCAGATTTTGCATCTGCCATGATCAAGATGGGAAATTATAAGCCTCTCACTGGTTCTAAAGGTCAGA
TCAGGCGAATTTGCAGTGCCGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACCTCTATTCGAAAAATCTCAGGAGCTGTCATGTTTATGGTCATGTTTCTGGTGTTGAACACATCATGCGAGGCTAAACTCAACTCTAAGTATTATGAGAAATCATGTCCAAAA
GCTCTCAGTACTATCAGAAGTACCATCAGGACGGCTATTGCACGAGAACGAAGAATGGCTGCATCTCTCATTCGTCTACACTTTCATGATTGTTTTGTCCAG
GGTTGTGATGGCTCAATC
CTACTGGATGAGACTTCCTCTATCAAGAGTGAGAAGACTGCATTGCCCAACTTAAATTCTGCTAGAGGTTTTGAAGTCATTGAAAAGGCAAAATCTCAAGTAGAGAAGATATGCCCAGGT
GTTGTATCCTGTGCAGATATCATTGCTGTGGCTGCAAGGGATGCTACTGAATAT
GTGGCTGGTCCATCTTACACTGTTTTGCTCGGAAGAAGAGATTCAACTACTGCAAGCAGAGATCGA
GCCAACAAAGAACTTCCTAGTTTTAGAGATGGTCTGGACAAACTTATATCTCGTTTTCAGAAAATAGGACTCAATGCTAGGGACTTGGTTGCTTTGTCAG
GTTCTCACACTCTAGGACAA
GCGCAGTGTGCTACCTTTCGTGACAGGATATACAGCAATGGCAGCGACATTGATGCTGGATTTGCTACCACTCGCCGGCGTCGTTGTCCTGCTGTTGGTGGCGACGGAAATCTGGCTCCA
CTTGATTTGGTCACACCCAATTCATGGGACAGCAATTACTTCAAGAATTTGATCCAAAAGAAAGGTCTTTTAGAATCAGATCAAGTACTCTTCAGTGGAGGTTCCACCGACAGTATTGTC
CGAGAATATAGCAAGAATCGTGCAGCTTTCAACGCAGATTTTGCATCTGCCATGATCAAGATGGGAAATTATAAGCCTCTCACTGGTTCTAAAGGTCAGATCAGGCGAATTTGCAGTGCC
GTGAAC

Retrieve as FASTA