Entry information : MePrx71 (cassava4.1_023529m)
Entry ID 9128
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx71 (cassava4.1_023529m)
Name (synonym) MePrx71 (cassava4.1_023529m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx71
start..stop
S start..stop
MePrx138 649 0 1..325 1..325
MePrx82 630 0 1..325 1..325
MePrx28 606 0 1..325 1..325
MePrx104 593 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 477629..477862 234 N° 2 477956..478147 192 N° 3 478247..478412 166 N° 4 478538..478920 383
join(477629..477862,477956..478147,478247..478412,478538..478920)


exon

Literature and cross-references MePrx71 (cassava4.1_023529m)
DNA ref. Phytozome 12:   scaffold08799 (477629..478920)
Protein sequence: MePrx71 (cassava4.1_023529m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (294)
PWM (Da):   %s   34913.75 (31632.0) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.32 (8.20) Peptide Signal:   %s   cut: 32 range:32-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIPLLNVSISPAKAAVFAFMVLLFYTACQAQLTSTFYDNACPNALKTIRTSIRNSIAAERRMAASLIRLHFHDCFVQGCDASILLEETPTIESEQTALPNKDSARGFRVIEKAKSEVEKICPGVVSCADIVAVAARDASAYVGGPSYTVMLGRRDSTTASRTLANNELPSFKDGLDRLISSFQRKGLSARDLVALSGAHTLGHAQCFTFRDRIYSNVSIDAGFASTRKRTCPAIGGDANLAPFDLVTPNSFDNNYFKNLIQKKGLLESDQILFSGGSTDSIVREYSRSPAAFNSDFAAAMIKMGNIDILTGTAGEIRKICSAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCCGCTTCTTAACGTTTCAATATCTCCAGCAAAAGCTGCAGTGTTCGCGTTTATGGTGCTGCTGTTTTACACTGCCTGCCAAGCTCAACTCACCTCTACATTTTATGACAAT
GCTTGTCCAAATGCACTCAAAACTATCCGAACTTCCATCAGAAATTCAATTGCCGCAGAACGAAGAATGGCAGCTTCTCTCATTCGTCTCCACTTTCATGATTGCTTTGTTCAG
GTACAA
TATATACATTGCACTCTTTTATATCTCCTGCCCTATATAATTAATTTTATTCTATGAGCATCGCTTAATGAATTCTTGATCTTGCAGGGTTGTGATGCATCAATCTTACTCGAAGAGACT
CCAACTATCGAGAGCGAACAGACTGCACTTCCCAATAAAGATTCCGCCAGAGGTTTTCGAGTCATCGAGAAAGCTAAATCTGAAGTAGAGAAGATATGCCCTGGAGTTGTATCTTGCGCA
GATATCGTCGCCGTGGCAGCAAGAGATGCATCTGCATAT
GTAATTAACTATATTTCAAACTCTTGCCTTCAGATGCTATACTCTTCTCAAGTTATTGTTTATTAATTTTTTTTGACATTT
TCTTCTGAAATATATCAGGTGGGAGGTCCATCTTATACAGTGATGCTTGGAAGAAGAGACTCAACTACTGCTAGCAGAACTCTTGCCAATAATGAACTTCCCAGTTTTAAAGATGGCCTG
GACAGACTTATATCTAGCTTTCAGCGTAAAGGACTTAGTGCAAGGGATCTGGTTGCCTTATCAG
GTATATATGCTAAAACTATTTTCATGTATTTTGCATTATCATATATCTTACAAGTG
ATCTTTTTCTTAGAAAAAAAACATTTCCATGTCTTCGATATGCTAAAAATATTTTAATTTCAAATGCAGGAGCTCATACCCTAGGCCACGCTCAATGCTTTACATTCCGTGATAGGATAT
ACAGCAATGTTTCAATTGATGCTGGATTTGCAAGCACCCGCAAGCGCACTTGTCCAGCTATTGGCGGTGATGCAAACTTGGCTCCCTTTGATTTGGTGACACCTAATTCTTTCGACAACA
ATTACTTCAAGAATCTCATACAAAAGAAAGGTCTTCTTGAATCTGATCAAATTCTTTTCAGTGGAGGTTCCACAGACAGCATTGTCCGAGAATATAGCAGGAGTCCTGCAGCTTTCAACT
CAGACTTTGCTGCTGCCATGATCAAAATGGGAAATATTGATATTCTCACTGGCACTGCTGGAGAAATAAGGAAGATCTGCAGTGCTGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCCGCTTCTTAACGTTTCAATATCTCCAGCAAAAGCTGCAGTGTTCGCGTTTATGGTGCTGCTGTTTTACACTGCCTGCCAAGCTCAACTCACCTCTACATTTTATGACAAT
GCTTGTCCAAATGCACTCAAAACTATCCGAACTTCCATCAGAAATTCAATTGCCGCAGAACGAAGAATGGCAGCTTCTCTCATTCGTCTCCACTTTCATGATTGCTTTGTTCAG
GGTTGT
GATGCATCAATCTTACTCGAAGAGACTCCAACTATCGAGAGCGAACAGACTGCACTTCCCAATAAAGATTCCGCCAGAGGTTTTCGAGTCATCGAGAAAGCTAAATCTGAAGTAGAGAAG
ATATGCCCTGGAGTTGTATCTTGCGCAGATATCGTCGCCGTGGCAGCAAGAGATGCATCTGCATAT
GTGGGAGGTCCATCTTATACAGTGATGCTTGGAAGAAGAGACTCAACTACTGCT
AGCAGAACTCTTGCCAATAATGAACTTCCCAGTTTTAAAGATGGCCTGGACAGACTTATATCTAGCTTTCAGCGTAAAGGACTTAGTGCAAGGGATCTGGTTGCCTTATCAG
GAGCTCAT
ACCCTAGGCCACGCTCAATGCTTTACATTCCGTGATAGGATATACAGCAATGTTTCAATTGATGCTGGATTTGCAAGCACCCGCAAGCGCACTTGTCCAGCTATTGGCGGTGATGCAAAC
TTGGCTCCCTTTGATTTGGTGACACCTAATTCTTTCGACAACAATTACTTCAAGAATCTCATACAAAAGAAAGGTCTTCTTGAATCTGATCAAATTCTTTTCAGTGGAGGTTCCACAGAC
AGCATTGTCCGAGAATATAGCAGGAGTCCTGCAGCTTTCAACTCAGACTTTGCTGCTGCCATGATCAAAATGGGAAATATTGATATTCTCACTGGCACTGCTGGAGAAATAAGGAAGATC
TGCAGTGCTGTGAAC

Retrieve as FASTA