Entry information : MePrx72 ( cassava4.1_023556m)
Entry ID 9129
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2016-01-17 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-17 (Achraf Jemmat)
Peroxidase information: MePrx72 ( cassava4.1_023556m)
Name (synonym) MePrx72 ( cassava4.1_023556m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx72
start..stop
S start..stop
MePrx86 514 0 1..325 1..333
RcPrx23 496 5e-179 1..325 1..326
VvPrx59 425 8e-151 16..324 18..328
EgrPrx126 415 9e-147 23..324 21..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2224060..2224275 216 N° 2 2223729..2223920 192 N° 3 2223482..2223647 166 N° 4 2223000..2223406 407
complement(join(2223000..2223406,2223482..2223647,2223729..2223920,2224060..2224 275))


exon

Literature and cross-references MePrx72 ( cassava4.1_023556m)
DNA ref. Phytozome 12:   scaffold01551 (2224275..2223000)
Protein sequence: MePrx72 ( cassava4.1_023556m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (301)
PWM (Da):   %s   35621.55 (32887.2)  
PI (pH):   %s   4.7 (4.67) Peptide Signal:   %s   cut: 27 range:27-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMGREGICVMLSLVVFGALTIRNADGLKQNFYHTSCPQVEPTVSTITRNRVQSNPALGAKLLRMHFHDCFVRGCDASILLDAVGSTKAEKDSIPDGSLSGYDVIDEIKSELEQICPGVVSCADILALAARDAVSFQFNNPLWEVLTGRRDGNLSLASDVDANLPSPFSDFNTLLQLYNDKGLDLDDLVILSGGHTIGVAHCATFSNRLYNFNGNNGSDPSLDPDYAEFLKTQCPNPFDPTTVEMDPQSSMVFDKSYFSILLQNKGLFQSDAALLQDERSARIVRQLNTSNDFFARFANSMKKMGAIEVLTGDAGQIRKNCHVANPQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGGTAGAGAAGGCATATGCGTTATGCTATCACTTGTTGTTTTTGGAGCTCTCACAATTCGTAATGCTGATGGGTTGAAGCAGAATTTCTACCACACAAGTTGCCCACAAGTTGAG
CCCACTGTGAGCACAATCACAAGAAATAGGGTCCAAAGTAACCCAGCTTTGGGCGCTAAACTCTTGAGGATGCATTTTCATGACTGTTTTGTTAGG
GTATGCCCTAATCTCTTCATGCAC
CAACTTAACTTCTATTTGTACTAACACTTTTTTCTTTCAAGCAAGTTTTGAATCCAACGATCATTTATATATAGATATAATTAAGAGTGTAGTTATGATTTGACGTGTGTTATAGGGATG
CGATGCATCGATACTGTTAGATGCAGTTGGAAGTACCAAAGCTGAAAAAGATTCAATTCCAGATGGATCATTGTCAGGTTATGATGTGATTGATGAAATTAAATCTGAACTCGAGCAAAT
TTGCCCTGGAGTTGTTTCATGTGCAGACATTCTTGCCTTGGCTGCTCGTGATGCTGTTTCCTTTCAG
GTAATACGTAGTTTCGTCATGAATATAAATATATTTCTATTTGCACATTTAAT
AAAAAAAGTTTACTCCATTGATTGCCAGTTTAATAATCCTTTATGGGAAGTCCTAACTGGAAGAAGAGATGGCAACCTTTCTCTCGCATCTGATGTGGATGCAAACCTTCCCTCGCCTTT
CTCAGACTTCAACACTCTCTTGCAACTATACAACGACAAGGGTCTTGATCTTGATGATCTTGTGATTCTATCAG
GTATAAAATTTCATCAATGTTTAATGGATGGAGGGTGCAATTATCA
TTTAATTAAAATTTAAACTGGAGCTGCAGGTGGTCACACAATAGGAGTTGCTCACTGTGCTACTTTCTCAAATAGGCTGTATAACTTCAATGGCAATAATGGAAGTGATCCTTCACTAGA
TCCAGACTACGCAGAATTCTTGAAAACCCAATGCCCTAATCCATTCGATCCAACAACGGTGGAGATGGATCCTCAAAGCTCAATGGTGTTTGATAAGAGTTACTTCAGTATCCTTCTCCA
AAACAAAGGACTTTTCCAGTCTGATGCTGCACTTCTCCAAGATGAACGATCCGCCAGAATTGTAAGACAGTTGAATACATCTAATGACTTTTTCGCCAGGTTTGCCAACTCGATGAAGAA
AATGGGGGCCATTGAAGTGCTTACAGGAGATGCTGGACAGATTAGGAAGAATTGCCATGTTGCAAATCCTCAAGGN

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGGTAGAGAAGGCATATGCGTTATGCTATCACTTGTTGTTTTTGGAGCTCTCACAATTCGTAATGCTGATGGGTTGAAGCAGAATTTCTACCACACAAGTTGCCCACAAGTTGAG
CCCACTGTGAGCACAATCACAAGAAATAGGGTCCAAAGTAACCCAGCTTTGGGCGCTAAACTCTTGAGGATGCATTTTCATGACTGTTTTGTTAGG
GGATGCGATGCATCGATACTGTTA
GATGCAGTTGGAAGTACCAAAGCTGAAAAAGATTCAATTCCAGATGGATCATTGTCAGGTTATGATGTGATTGATGAAATTAAATCTGAACTCGAGCAAATTTGCCCTGGAGTTGTTTCA
TGTGCAGACATTCTTGCCTTGGCTGCTCGTGATGCTGTTTCCTTTCAG
TTTAATAATCCTTTATGGGAAGTCCTAACTGGAAGAAGAGATGGCAACCTTTCTCTCGCATCTGATGTGGAT
GCAAACCTTCCCTCGCCTTTCTCAGACTTCAACACTCTCTTGCAACTATACAACGACAAGGGTCTTGATCTTGATGATCTTGTGATTCTATCAG
GTGGTCACACAATAGGAGTTGCTCAC
TGTGCTACTTTCTCAAATAGGCTGTATAACTTCAATGGCAATAATGGAAGTGATCCTTCACTAGATCCAGACTACGCAGAATTCTTGAAAACCCAATGCCCTAATCCATTCGATCCAACA
ACGGTGGAGATGGATCCTCAAAGCTCAATGGTGTTTGATAAGAGTTACTTCAGTATCCTTCTCCAAAACAAAGGACTTTTCCAGTCTGATGCTGCACTTCTCCAAGATGAACGATCCGCC
AGAATTGTAAGACAGTTGAATACATCTAATGACTTTTTCGCCAGGTTTGCCAACTCGATGAAGAAAATGGGGGCCATTGAAGTGCTTACAGGAGATGCTGGACAGATTAGGAAGAATTGC
CATGTTGCAAATCCTCAAGGN

Retrieve as FASTA