Entry information : SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Entry ID 913
Creation 2008-09-02 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Name (synonym) SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation Thylakoid-bound
Tissue types Leaves
Roots
Inducers Colletotrichum inoculation
Oxidative stress
Pathogen interaction
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value SbAPx04
start..stop
S start..stop
ZmAPx04 556 0 1..289 1..289
OsAPx04 516 0 1..289 1..291
ScAPx04 510 0 1..289 1..291
TaAPx06 506 0 1..289 1..291
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 59856509..59856621 113 N° 2 59857620..59857744 125 N° 3 59858344..59858393 50 N° 4 59858538..59858603 66
N° 5 59858682..59858730 49 N° 6 59859166..59859248 83 N° 7 59859321..59859400 80 N° 8 59859497..59859599 103
N° 9 59859707..59859907 201  
join(59856509..59856621,59857620..59857744,59858344..59858393,59858538..59858603 ,59858682..59858730,59859166..59859248,59859321..59859400,59859497..59859599,598 59707..59859907)


exon

Literature and cross-references SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., An EST database from Sorghum: acid- and alkaline-treated roots. unpublished
DNA ref. Phytozome 11:   chromosome_7 (59856509..59859907)
EST ref. GenBank:   CN127917.1 [5' end]   CN127831.1 [3' end]
Cluster/Prediction ref. UniGene:   Sbi.4502
Protein sequence: SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   289
PWM (Da):   %s   31441.32 Transmb domain:   %s   o260-282i
PI (pH):   %s   7.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPVVDAEYLRQVDRARRHLRALISNKGCAPIMLRLAWHDAGTYDVKTKTGGANGSIRYEEEYTHGSNAGLKIAIDLEPIKAKNPKITYADLYLAGVVAVEVTGGPTVEFIPGRRDSSVCPREGRLPDAKKGAPHLRDIFYRMGLSDKDIVALSGGHTGRAHPDRSGFEGAWTKEPLKFDNSYFLELLIEESEGLLKLPTDKALLSDPEFRRYVDLYADEDAFFKDYAESHKKLSELGFTPRSTASAKSDLPTGAVLAQSAFGVAVAAAVVIAGYLYEASKKAK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 8 introns) and 34 ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCCGTGGTCGACGCCGAGTACCTGCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCGATCATGCTCCGCCTCGCGTACGTA
CATACGCCAATCACTCACCCTCCTCACGCACTCGTGTACTCCCCCGGACCCCCCAACTACTGCTGACTTTTTCCCCCCGCGGCCCTGTTGCCTCTGATTGGCATGGGGATTCCAGGGCTG
TTGAACCCTTGATGGCTTAGTCTGTAGCGCGCTTGCTTGCTGCTCTCTCGTGCTTCACGGTTGAGCTGACTGGCGTGTGAGGTTTGCGCGCCTGGTTTCGTGCCTAGTCGCGGTTTCGTC
TGATTTGGTTTCGCTCTTTGCTGAGGCAATTTATCGAGCACTTTGCCTGCGTGTTCGCGTGCGCGTGCCCTAGCGCATAAGCGTCTCCTAATCTTAGTTTCCTTGCCGCGGCTGTCGCAC
TGACACGAAGGGTAGGTGGTGATGAATTTCGGGTTATTAAATTCACATCTTAATCTTGTTAGAATTGTTAGGATAGAACACTTAGTCAAATCACAACAATAGCCCAATCTGTGTCATACA
GTAGTGCTGCAACTGTCACAACCGTTTTTCTTAGTTCCATAGATAGATCGTGGAAAGCTCAGACAAGATGCCTGTTCTAGCTCAACTAGGATTACCTTTGCTTTACTCATGTCATTATGT
GGACTGTGGAATTGGTGACAGGTGGGTAGGGTACTAGGGTACCTCTGTATTCCTGTTTGAGTTAGGACTTGGGAGAAAGTATTTTATCGGCTAATAGACGAAAATATATGGTGCTTACTT
GGTGACAGCTTATGAGAAGCTCCAGTAGAGCACAATTTTGTAGAGGACCACTCCAACTGATATGGCTCACTAGCGTTATGTTGGAGTTCCCATACTTTTACATACATTGGATTCATATTT
ATACTATTGATATGATAACCAGTTAAATCACACCAAATTGGCCTCCATTTTCTGTAGGATTCTTCCAGAAATGTATCCTGCTTAATATGAATTGAGCTTACACCATTCTTCCTGTCATTC
AAACACTGAAGACTTTTGCTCTCCCTTGCAGATGGCATGATGCTGGAACTTATGACGTGAAGACAAAGACCGGTGGTGCAAATGGTTCGATTAGATATGAGGAAGAGTACACCCATGGCT
CAAATGCTGGTTTAAAGATTGCCATCGATCTCCTTG
GTATGCATTATTTATACTCAATACGATACTGGATGCCTGTGCAAGAGTATTATTGTTATTATTATATCGACCTATAAACTAAGT
ATGATCTACTTGAATGAGGATTTTGAAGAAATCAATTTGCAATTTTTTTCTAGTTTCTTTCTGATAAACTGAAACTCCTTTTCTGTGACTGGGTTTTCTGCTACCTTCAAGGTCAGATAA
CAAAATAATGGATTTTCATTCAGTTATTCTGGGATGATAAATTGAGAAAATTATATAGTATGATTTTAGCTGTTGCTGCTTAGAGAAGTCCTCCCATAATCATCTACTTGGTCAGAACTA
TTAGTTTTAGGTCTATTCCCTGCCATTCAGACATGCAGTTAGATTATGTACTCATGACAATGGTTACCTGTATTATACTATAAAGCCTTAAATGTAAAATCAAAAGGTGTCTTAGTCAGA
GCAACTGCAGTTTATGAGAATGCTACTGTTTGTAAATCATACTCCATGTGGAATCATGGTGATTTGTATTTCTTGTTTCCTTCTGTATTTCTTCGCTTCTGAAATAAATGAAATCATTAG
TATTGCTTATTCAGTTGTCTCTTGTTTTCCTCTAGAGCCTATCAAAGCAAAGAATCCCAAGATAACATATGCAGACCTTTATCAGGTAACTTGGGATCACCTTAAATTTGCTCTTCTATA
GGTTGTCTGGCTTTTTTAACCCTGTTGTGATTGGACTTTTTTATCCTGTTGGGAAGGGTGAAACTCTGAATTCAGTATAAATACTGACCTGCTAAGTATTTATAAACAGCTTGCTGGAGT
GGTTGCAGTTGAAGTGACTGGGGGACCAACTGTTGAGTTTATTCCTGGGAGACGT
GTATGTAAAAAAACCATTCCTTCATAATTGGATTCATTTTTCCTGATGTTCACTCTGTAACTGGT
TGACGTTAATCAGGATTCGTCAGTGTGCCCCCGTGAAGGGCGTCTGCCAGATGCTAAGAAAGGTATTTACTACCTTGGCCTATACTCGTGTGGTTTTAACTGTAACATGCCATGTATCCT
AAGTTCCTAACATTATTCCTTTAACATGATTAATTGATTACTCTGGAAGTTTGAGAGGGAGGGAAGGAAGGATGGTACTGCGTAATTCATGTGTAAAACCTTCTTGTTGCTTCTCAACAT
CAAACTGTTATGTGTATCTGCGCTCCATGTTTGCTCGTGGATTTCTTGCCTGAAGTCTTATTGAAAAACACAAATATCATTTTCTATTAGGAACTGTTCCTGCATTTCTCCATATAACTA
GTACTATATACAACATGTGTCTGTATCCAGCTTTGGTAATTTTTATCCTGATGGCTTTGGTGTTATTCTGTACTTATTATTTGATCGCATCTGTTGCTAATGTACATCTCGTTTTTTTGG
CTTCTTTGCACGAATAGGTGCACCACATCTGAGGGACATCTTTTATCGGATGGGCTTATCGGACAAAGATATTGTAGCTCTATCAGGGGGCCATACTCTGGTAAATTGTTATAGTCTCTG
AAGGAGAAACTCATTTGTTCATGAGTGCATCTTAATACCTTTGTTCTTTTAGGGAAGGGCTCATCCTGACAGGTCTGGATTCGAAGGTGCCTGGACAAAGGAGCCTCTTAAGTTTGATAA
CTCATACTTTCT
GTAAGTCGAACAAAGTCAGAATTTCTACTTGGTTTGCTGACTAGATTCCATACGGTAAACGAGAGTGTTGTCGACTAATTTATTATGTTATTGCAGTGAGCTGTTGAT
TGAGGAATCTGAGGGGCTTTTAAAGCTCCCAACTGATAAGGCACTGTTATCAGATCCTGAGTTTAGGCGCTATGTGGACCTTTATGCAAAG
GTGAATAGGACTTATAAGTTATCATTATG
CACAGCACACTTTAGCACCTTGTTTGGTTAAGGTTCAGATCCACTGATTCAGAACCATGTCTTTTGTTCATACCGCAGGATGAAGATGCCTTCTTCAAGGACTACGCTGAATCACACAAG
AAACTCTCTGAGCTTGGCTTCACGCCTCGCAGCACAGCATCAGCCAAATCAGACCTTCCAACCGGTGCTGTACTTGCACAGAGCGCCTTTGGGGTAGCGGTTGCTGCAGCCGTAGTCATC
GCTGGCTACTTGTACGAGGCTTCCAAGAAGGCCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCCGTGGTCGACGCCGAGTACCTGCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCGATCATGCTCCGCCTCGCATGGCAT
GATGCTGGAACTTATGACGTGAAGACAAAGACCGGTGGTGCAAATGGTTCGATTAGATATGAGGAAGAGTACACCCATGGCTCAAATGCTGGTTTAAAGATTGCCATCGATCTCCTTG
AG
CCTATCAAAGCAAAGAATCCCAAGATAACATATGCAGACCTTTATCAG
CTTGCTGGAGTGGTTGCAGTTGAAGTGACTGGGGGACCAACTGTTGAGTTTATTCCTGGGAGACGTGATTCG
TCAGTGTGCCCCCGTGAAGGGCGTCTGCCAGATGCTAAGAAAG
GTGCACCACATCTGAGGGACATCTTTTATCGGATGGGCTTATCGGACAAAGATATTGTAGCTCTATCAGGGGGCCAT
ACTCTG
GGAAGGGCTCATCCTGACAGGTCTGGATTCGAAGGTGCCTGGACAAAGGAGCCTCTTAAGTTTGATAACTCATACTTTCTTGAGCTGTTGATTGAGGAATCTGAGGGGCTTTTA
AAGCTCCCAACTGATAAGGCACTGTTATCAGATCCTGAGTTTAGGCGCTATGTGGACCTTTATGCAAAG
GATGAAGATGCCTTCTTCAAGGACTACGCTGAATCACACAAGAAACTCTCT
GAGCTTGGCTTCACGCCTCGCAGCACAGCATCAGCCAAATCAGACCTTCCAACCGGTGCTGTACTTGCACAGAGCGCCTTTGGGGTAGCGGTTGCTGCAGCCGTAGTCATCGCTGGCTAC
TTGTACGAGGCTTCCAAGAAGGCCAAGTAG

Retrieve as FASTA