Entry information : SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Entry ID 913
Creation 2008-09-02 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Name (synonym) SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation Thylakoid-bound
Tissue types Leaves
Roots
Inducers Colletotrichum inoculation
Oxidative stress
Pathogen interaction
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value SbAPx04
start..stop
S start..stop
ZmAPx04 556 0 1..289 1..289
OsAPx04 516 0 1..289 1..291
ScAPx04 510 0 1..289 1..291
TaAPx06 506 0 1..289 1..291
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 59856509..59856621 113 N° 2 59857620..59857744 125 N° 3 59858344..59858393 50 N° 4 59858538..59858603 66
N° 5 59858682..59858730 49 N° 6 59859166..59859248 83 N° 7 59859321..59859400 80 N° 8 59859497..59859599 103
N° 9 59859707..59859907 201  
join(59856509..59856621,59857620..59857744,59858344..59858393,59858538..59858603 ,59858682..59858730,59859166..59859248,59859321..59859400,59859497..59859599,598 59707..59859907)


exon

Literature and cross-references SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., An EST database from Sorghum: acid- and alkaline-treated roots. unpublished
DNA ref. Phytozome 11:   chromosome_7 (59856509..59859907)
EST ref. GenBank:   CN127917.1 [5' end]   CN127831.1 [3' end]
Cluster/Prediction ref. UniGene:   Sbi.4502
Protein sequence: SbAPx04 (Sobic.007G177000.1 [2.1] / Sb07g024880 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 289
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
31441.32 Transmb domain: %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
o260-282i
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
7.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPVVDAEYLRQVDRARRHLRALISNKGCAPIMLRLAWHDAGTYDVKTKTGGANGSIRYEEEYTHGSNAGLKIAIDLEPIKAKNPKITYADLYLAGVVAVEVTGGPTVEFIPGRRDSSVCPREGRLPDAKKGAPHLRDIFYRMGLSDKDIVALSGGHTGRAHPDRSGFEGAWTKEPLKFDNSYFLELLIEESEGLLKLPTDKALLSDPEFRRYVDLYADEDAFFKDYAESHKKLSELGFTPRSTASAKSDLPTGAVLAQSAFGVAVAAAVVIAGYLYEASKKAK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 8 introns) and 34 ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCCGTGGTCGACGCCGAGTACCTGCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCGATCATGCTCCGCCTCGCGTACGTA
CATACGCCAATCACTCACCCTCCTCACGCACTCGTGTACTCCCCCGGACCCCCCAACTACTGCTGACTTTTTCCCCCCGCGGCCCTGTTGCCTCTGATTGGCATGGGGATTCCAGGGCTG
TTGAACCCTTGATGGCTTAGTCTGTAGCGCGCTTGCTTGCTGCTCTCTCGTGCTTCACGGTTGAGCTGACTGGCGTGTGAGGTTTGCGCGCCTGGTTTCGTGCCTAGTCGCGGTTTCGTC
TGATTTGGTTTCGCTCTTTGCTGAGGCAATTTATCGAGCACTTTGCCTGCGTGTTCGCGTGCGCGTGCCCTAGCGCATAAGCGTCTCCTAATCTTAGTTTCCTTGCCGCGGCTGTCGCAC
TGACACGAAGGGTAGGTGGTGATGAATTTCGGGTTATTAAATTCACATCTTAATCTTGTTAGAATTGTTAGGATAGAACACTTAGTCAAATCACAACAATAGCCCAATCTGTGTCATACA
GTAGTGCTGCAACTGTCACAACCGTTTTTCTTAGTTCCATAGATAGATCGTGGAAAGCTCAGACAAGATGCCTGTTCTAGCTCAACTAGGATTACCTTTGCTTTACTCATGTCATTATGT
GGACTGTGGAATTGGTGACAGGTGGGTAGGGTACTAGGGTACCTCTGTATTCCTGTTTGAGTTAGGACTTGGGAGAAAGTATTTTATCGGCTAATAGACGAAAATATATGGTGCTTACTT
GGTGACAGCTTATGAGAAGCTCCAGTAGAGCACAATTTTGTAGAGGACCACTCCAACTGATATGGCTCACTAGCGTTATGTTGGAGTTCCCATACTTTTACATACATTGGATTCATATTT
ATACTATTGATATGATAACCAGTTAAATCACACCAAATTGGCCTCCATTTTCTGTAGGATTCTTCCAGAAATGTATCCTGCTTAATATGAATTGAGCTTACACCATTCTTCCTGTCATTC
AAACACTGAAGACTTTTGCTCTCCCTTGCAGATGGCATGATGCTGGAACTTATGACGTGAAGACAAAGACCGGTGGTGCAAATGGTTCGATTAGATATGAGGAAGAGTACACCCATGGCT
CAAATGCTGGTTTAAAGATTGCCATCGATCTCCTTG
GTATGCATTATTTATACTCAATACGATACTGGATGCCTGTGCAAGAGTATTATTGTTATTATTATATCGACCTATAAACTAAGT
ATGATCTACTTGAATGAGGATTTTGAAGAAATCAATTTGCAATTTTTTTCTAGTTTCTTTCTGATAAACTGAAACTCCTTTTCTGTGACTGGGTTTTCTGCTACCTTCAAGGTCAGATAA
CAAAATAATGGATTTTCATTCAGTTATTCTGGGATGATAAATTGAGAAAATTATATAGTATGATTTTAGCTGTTGCTGCTTAGAGAAGTCCTCCCATAATCATCTACTTGGTCAGAACTA
TTAGTTTTAGGTCTATTCCCTGCCATTCAGACATGCAGTTAGATTATGTACTCATGACAATGGTTACCTGTATTATACTATAAAGCCTTAAATGTAAAATCAAAAGGTGTCTTAGTCAGA
GCAACTGCAGTTTATGAGAATGCTACTGTTTGTAAATCATACTCCATGTGGAATCATGGTGATTTGTATTTCTTGTTTCCTTCTGTATTTCTTCGCTTCTGAAATAAATGAAATCATTAG
TATTGCTTATTCAGTTGTCTCTTGTTTTCCTCTAGAGCCTATCAAAGCAAAGAATCCCAAGATAACATATGCAGACCTTTATCAGGTAACTTGGGATCACCTTAAATTTGCTCTTCTATA
GGTTGTCTGGCTTTTTTAACCCTGTTGTGATTGGACTTTTTTATCCTGTTGGGAAGGGTGAAACTCTGAATTCAGTATAAATACTGACCTGCTAAGTATTTATAAACAGCTTGCTGGAGT
GGTTGCAGTTGAAGTGACTGGGGGACCAACTGTTGAGTTTATTCCTGGGAGACGT
GTATGTAAAAAAACCATTCCTTCATAATTGGATTCATTTTTCCTGATGTTCACTCTGTAACTGGT
TGACGTTAATCAGGATTCGTCAGTGTGCCCCCGTGAAGGGCGTCTGCCAGATGCTAAGAAAGGTATTTACTACCTTGGCCTATACTCGTGTGGTTTTAACTGTAACATGCCATGTATCCT
AAGTTCCTAACATTATTCCTTTAACATGATTAATTGATTACTCTGGAAGTTTGAGAGGGAGGGAAGGAAGGATGGTACTGCGTAATTCATGTGTAAAACCTTCTTGTTGCTTCTCAACAT
CAAACTGTTATGTGTATCTGCGCTCCATGTTTGCTCGTGGATTTCTTGCCTGAAGTCTTATTGAAAAACACAAATATCATTTTCTATTAGGAACTGTTCCTGCATTTCTCCATATAACTA
GTACTATATACAACATGTGTCTGTATCCAGCTTTGGTAATTTTTATCCTGATGGCTTTGGTGTTATTCTGTACTTATTATTTGATCGCATCTGTTGCTAATGTACATCTCGTTTTTTTGG
CTTCTTTGCACGAATAGGTGCACCACATCTGAGGGACATCTTTTATCGGATGGGCTTATCGGACAAAGATATTGTAGCTCTATCAGGGGGCCATACTCTGGTAAATTGTTATAGTCTCTG
AAGGAGAAACTCATTTGTTCATGAGTGCATCTTAATACCTTTGTTCTTTTAGGGAAGGGCTCATCCTGACAGGTCTGGATTCGAAGGTGCCTGGACAAAGGAGCCTCTTAAGTTTGATAA
CTCATACTTTCT
GTAAGTCGAACAAAGTCAGAATTTCTACTTGGTTTGCTGACTAGATTCCATACGGTAAACGAGAGTGTTGTCGACTAATTTATTATGTTATTGCAGTGAGCTGTTGAT
TGAGGAATCTGAGGGGCTTTTAAAGCTCCCAACTGATAAGGCACTGTTATCAGATCCTGAGTTTAGGCGCTATGTGGACCTTTATGCAAAG
GTGAATAGGACTTATAAGTTATCATTATG
CACAGCACACTTTAGCACCTTGTTTGGTTAAGGTTCAGATCCACTGATTCAGAACCATGTCTTTTGTTCATACCGCAGGATGAAGATGCCTTCTTCAAGGACTACGCTGAATCACACAAG
AAACTCTCTGAGCTTGGCTTCACGCCTCGCAGCACAGCATCAGCCAAATCAGACCTTCCAACCGGTGCTGTACTTGCACAGAGCGCCTTTGGGGTAGCGGTTGCTGCAGCCGTAGTCATC
GCTGGCTACTTGTACGAGGCTTCCAAGAAGGCCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCCGTGGTCGACGCCGAGTACCTGCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCGATCATGCTCCGCCTCGCATGGCAT
GATGCTGGAACTTATGACGTGAAGACAAAGACCGGTGGTGCAAATGGTTCGATTAGATATGAGGAAGAGTACACCCATGGCTCAAATGCTGGTTTAAAGATTGCCATCGATCTCCTTG
AG
CCTATCAAAGCAAAGAATCCCAAGATAACATATGCAGACCTTTATCAG
CTTGCTGGAGTGGTTGCAGTTGAAGTGACTGGGGGACCAACTGTTGAGTTTATTCCTGGGAGACGTGATTCG
TCAGTGTGCCCCCGTGAAGGGCGTCTGCCAGATGCTAAGAAAG
GTGCACCACATCTGAGGGACATCTTTTATCGGATGGGCTTATCGGACAAAGATATTGTAGCTCTATCAGGGGGCCAT
ACTCTG
GGAAGGGCTCATCCTGACAGGTCTGGATTCGAAGGTGCCTGGACAAAGGAGCCTCTTAAGTTTGATAACTCATACTTTCTTGAGCTGTTGATTGAGGAATCTGAGGGGCTTTTA
AAGCTCCCAACTGATAAGGCACTGTTATCAGATCCTGAGTTTAGGCGCTATGTGGACCTTTATGCAAAG
GATGAAGATGCCTTCTTCAAGGACTACGCTGAATCACACAAGAAACTCTCT
GAGCTTGGCTTCACGCCTCGCAGCACAGCATCAGCCAAATCAGACCTTCCAACCGGTGCTGTACTTGCACAGAGCGCCTTTGGGGTAGCGGTTGCTGCAGCCGTAGTCATCGCTGGCTAC
TTGTACGAGGCTTCCAAGAAGGCCAAGTAG

Retrieve as FASTA