Entry information : MePrx79 (cassava4.1_024710m)
Entry ID 9134
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx79 (cassava4.1_024710m)
Name (synonym) MePrx79 (cassava4.1_024710m)
Class Class III peroxidase    [Orthogroup: Prx031]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx79
start..stop
S start..stop
PpePrx68 448 2e-159 7..326 7..328
CclPrx109 443 9e-158 2..324 1..324
PtPrx88 431 7e-153 3..324 1..323
LuPrx26 419 2e-148 24..324 12..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 642551..642775 225 N° 2 642871..643050 180 N° 3 643172..643331 160 N° 4 643428..643873 446
join(642551..642775,642871..643050,643172..643331,643428..643873)


exon

Literature and cross-references MePrx79 (cassava4.1_024710m)
DNA ref. Phytozome 12:   scaffold05859 (642551..643873)
Protein sequence: MePrx79 (cassava4.1_024710m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (310)
PWM (Da):   %s   36431.13 (33519.7)  
PI (pH):   %s   7.16 (6.50) Peptide Signal:   %s   cut: 28 range:28-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMMMRRVAALGLALSFISVHLTGQCHGQLQVGFYKGKCKFDVESIVRGVVEAKFITDKTITAALLRLHFHDCFVHGCDASILLEGSNSEKTAQPNLSVRGYDIIDAAKAAVEFFCPGLVSCADIIAMATRDSVLLAKGGWYNVQTGRRDGSVSSAQDVNLPSPSFNIPEAVAAFASKGLDVTDMVYLLGGHTVGLTHCSFFQDRLYNFQDTGKPDPTMDATLLSMLRQRCPQNSAGTNTTFLDQNPSSSFTVDNSFYQQILMHKGVLQVDQELALDPITKSIVATIANGKDFSYNFGRAMVKLGAVQVLTGNQGEIRRDCRSVNNPSNSSSNSNIE

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGATGATGAGAAGAGTAGCTGCATTGGGTTTAGCCCTTTCTTTCATCTCTGTGCACTTGACAGGCCAATGCCATGGTCAGTTGCAAGTTGGGTTCTATAAAGGCAAGTGTAAGTTT
GATGTTGAGTCTATTGTACGTGGTGTAGTAGAAGCAAAATTCATCACTGACAAAACAATCACCGCTGCTCTTCTTCGCTTGCACTTCCATGACTGTTTTGTTCAT
GTAAGCTTTTTAGTT
TTGTTCTTGTTTAGTTTGGACAGACCATTTCTTGAATCCATCAGCTAATTGATATACATTATTGTGTGTGATGTGAAAAGGGCTGCGATGCATCGATTCTGCTTGAGGGAAGCAACAGCG
AGAAAACTGCGCAACCCAATCTAAGCGTAAGGGGTTATGATATAATTGATGCTGCCAAGGCTGCTGTTGAATTCTTCTGTCCAGGACTCGTCTCTTGTGCTGATATTATAGCAATGGCTA
CCAGAGACTCTGTTCTCCTT
GTAAGTTGCATTGTATTTCTCACATTATCCAATACTCATCAGTTTATATTACTGTGCAAATCTTGAAAGCGGAGTTGAATTATGCAAATAAATCTTAATC
ATTTTTTTTTCTTTCTTTCAGGCAAAAGGAGGATGGTACAATGTACAAACGGGGAGAAGAGATGGGTCTGTGTCTTCTGCTCAAGATGTTAACCTGCCATCTCCAAGTTTTAATATTCCT
GAAGCTGTTGCAGCATTTGCTTCTAAAGGACTTGATGTTACAGACATGGTTTATCTTCTGG
GTACTTCAAAATCTCCCATAATTTACCAGCTTCCTTTCTTTTAGTCATTCAAGAATGTG
TTATAATTTGTGCTCTGTGAATCTTGTTAATGCACAGGTGGCCACACCGTTGGGTTAACACATTGTTCGTTCTTCCAAGATCGTCTTTACAATTTTCAAGATACTGGAAAACCTGACCCA
ACCATGGATGCAACATTACTCAGCATGCTAAGACAAAGGTGTCCCCAAAATTCAGCTGGAACCAACACAACTTTTCTTGATCAGAACCCTTCCAGTTCTTTCACTGTGGACAACTCTTTC
TACCAACAAATTCTAATGCATAAAGGGGTGCTCCAAGTTGATCAAGAACTGGCCTTGGACCCCATCACCAAATCCATAGTGGCAACCATAGCTAATGGTAAGGATTTCTCCTACAACTTT
GGTCGAGCGATGGTTAAGTTGGGAGCTGTCCAAGTCCTCACTGGAAATCAAGGAGAGATCAGGAGAGATTGTCGATCAGTTAACAATCCATCTAACAGCAGTTCTAATTCCAACATTGAA
GAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGATGATGAGAAGAGTAGCTGCATTGGGTTTAGCCCTTTCTTTCATCTCTGTGCACTTGACAGGCCAATGCCATGGTCAGTTGCAAGTTGGGTTCTATAAAGGCAAGTGTAAGTTT
GATGTTGAGTCTATTGTACGTGGTGTAGTAGAAGCAAAATTCATCACTGACAAAACAATCACCGCTGCTCTTCTTCGCTTGCACTTCCATGACTGTTTTGTTCAT
GGCTGCGATGCATCG
ATTCTGCTTGAGGGAAGCAACAGCGAGAAAACTGCGCAACCCAATCTAAGCGTAAGGGGTTATGATATAATTGATGCTGCCAAGGCTGCTGTTGAATTCTTCTGTCCAGGACTCGTCTCT
TGTGCTGATATTATAGCAATGGCTACCAGAGACTCTGTTCTCCTT
GCAAAAGGAGGATGGTACAATGTACAAACGGGGAGAAGAGATGGGTCTGTGTCTTCTGCTCAAGATGTTAACCTG
CCATCTCCAAGTTTTAATATTCCTGAAGCTGTTGCAGCATTTGCTTCTAAAGGACTTGATGTTACAGACATGGTTTATCTTCTGG
GTGGCCACACCGTTGGGTTAACACATTGTTCGTTC
TTCCAAGATCGTCTTTACAATTTTCAAGATACTGGAAAACCTGACCCAACCATGGATGCAACATTACTCAGCATGCTAAGACAAAGGTGTCCCCAAAATTCAGCTGGAACCAACACAACT
TTTCTTGATCAGAACCCTTCCAGTTCTTTCACTGTGGACAACTCTTTCTACCAACAAATTCTAATGCATAAAGGGGTGCTCCAAGTTGATCAAGAACTGGCCTTGGACCCCATCACCAAA
TCCATAGTGGCAACCATAGCTAATGGTAAGGATTTCTCCTACAACTTTGGTCGAGCGATGGTTAAGTTGGGAGCTGTCCAAGTCCTCACTGGAAATCAAGGAGAGATCAGGAGAGATTGT
CGATCAGTTAACAATCCATCTAACAGCAGTTCTAATTCCAACATTGAAGAA

Retrieve as FASTA