Entry information : MePrx82 (cassava4.1_025263m)
Entry ID 9137
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx82 (cassava4.1_025263m)
Name (synonym) MePrx82 (cassava4.1_025263m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx82
start..stop
S start..stop
MePrx71 630 0 1..325 1..325
MePrx138 629 0 1..325 1..325
MePrx28 594 0 1..325 1..325
MePrx104 594 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 473889..474122 234 N° 2 474216..474407 192 N° 3 474506..474671 166 N° 4 474795..475177 383
join(473889..474122,474216..474407,474506..474671,474795..475177)


exon

Literature and cross-references MePrx82 (cassava4.1_025263m)
DNA ref. Phytozome 12:   scaffold08799 (473889..475177)
Protein sequence: MePrx82 (cassava4.1_025263m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (294)
PWM (Da):   %s   34892.72 (31648.0)  
PI (pH):   %s   8.14 (7.98) Peptide Signal:   %s   cut: 32 range:32-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIPLLNISTSPAKAALFVFVVLLFNTACQAQLTSTFYDSSCPNALRTIRTSIRNSIAAERRMAASLIRLHFHDCFVQGCDASILLEETPTIESEQTALPNKDSARGYRVIEKAKSEVEKICPGVVSCADILAVAARDASAYVGGPSYTVMLGRRDSTTASRNLANSELPSFKDGLDRLISSFQNKGLSPRDLVALSGAHTLGHAQCFTFRDRIYSNVSIDAGFASTRKRTCPAVDGDANLAPFDLVTPNSFDNNYFKNLIQKKGLLESDQVLFSGGSTDSIVREYSRSPAAFNSDFAAATIKMGNINILTGTAGEIRKICSAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCCACTTCTTAACATTTCAACATCTCCAGCAAAAGCTGCATTGTTCGTATTTGTGGTGCTGTTGTTTAACACTGCATGCCAAGCTCAACTCACCTCTACATTTTATGACAGT
TCTTGTCCAAATGCACTCAGAACTATCCGAACTTCTATCAGAAATTCAATTGCTGCAGAACGAAGAATGGCAGCTTCTCTCATTCGCCTCCACTTTCATGATTGCTTTGTTCAG
GTACTA
TACATATATTGCTCTATTTTATATTTCCTTCCATATATAACTAATATCATTCTATGAGCATTGCTTAATGAATTCTTGGTCTTGCAGGGTTGTGATGCGTCAATCTTACTCGAAGAGACT
CCAACTATCGAGAGCGAACAAACTGCACTTCCCAATAAAGATTCCGCCAGAGGCTATCGAGTCATTGAGAAAGCAAAATCTGAAGTAGAGAAAATATGCCCTGGAGTTGTATCTTGTGCA
GATATCCTCGCTGTGGCAGCAAGAGATGCATCTGCATAT
GTAATTAACTATATTTCAAACTCTTGCATTCAGATGCTATACTCTTCTCAAGTTATTGTTTATTAATTTTTTTGACATTTT
CTTCTGAAATATATCAGGTGGGGGGTCCATCTTATACAGTGATGCTTGGAAGAAGAGACTCAACAACTGCTAGTAGAAATCTTGCCAATAGTGAACTTCCCAGTTTTAAAGATGGCCTGG
ACAGACTTATATCTAGCTTTCAGAATAAAGGCCTTAGTCCAAGGGATCTGGTTGCCTTGTCAG
GTGTATATGCTAAAACTATATTCATATATTTTATATAATCATATATATTACAAATCT
TTTTCTTAGCAACAAAACATTTTCTTGGCCTTTATATGCTAAAAATATTTTAATTTCCAATTGCAGGGGCTCATACTCTAGGCCACGCTCAATGCTTTACATTTCGTGATAGGATATACA
GCAATGTTTCTATTGATGCTGGATTTGCAAGCACCCGCAAGCGCACTTGTCCAGCTGTTGACGGTGATGCAAACTTGGCTCCCTTTGATTTGGTCACACCTAATTCTTTCGACAACAATT
ACTTCAAGAATCTCATACAAAAGAAAGGTCTTCTTGAATCTGATCAAGTTCTTTTTAGCGGAGGCTCCACAGATAGCATTGTCCGAGAATATAGCAGGAGTCCTGCAGCTTTCAACTCAG
ACTTTGCTGCTGCCACGATCAAAATGGGAAATATCAATATTCTCACTGGCACTGCTGGGGAAATAAGGAAGATCTGCAGTGCTGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCCACTTCTTAACATTTCAACATCTCCAGCAAAAGCTGCATTGTTCGTATTTGTGGTGCTGTTGTTTAACACTGCATGCCAAGCTCAACTCACCTCTACATTTTATGACAGT
TCTTGTCCAAATGCACTCAGAACTATCCGAACTTCTATCAGAAATTCAATTGCTGCAGAACGAAGAATGGCAGCTTCTCTCATTCGCCTCCACTTTCATGATTGCTTTGTTCAG
GGTTGT
GATGCGTCAATCTTACTCGAAGAGACTCCAACTATCGAGAGCGAACAAACTGCACTTCCCAATAAAGATTCCGCCAGAGGCTATCGAGTCATTGAGAAAGCAAAATCTGAAGTAGAGAAA
ATATGCCCTGGAGTTGTATCTTGTGCAGATATCCTCGCTGTGGCAGCAAGAGATGCATCTGCATAT
GTGGGGGGTCCATCTTATACAGTGATGCTTGGAAGAAGAGACTCAACAACTGCT
AGTAGAAATCTTGCCAATAGTGAACTTCCCAGTTTTAAAGATGGCCTGGACAGACTTATATCTAGCTTTCAGAATAAAGGCCTTAGTCCAAGGGATCTGGTTGCCTTGTCAG
GGGCTCAT
ACTCTAGGCCACGCTCAATGCTTTACATTTCGTGATAGGATATACAGCAATGTTTCTATTGATGCTGGATTTGCAAGCACCCGCAAGCGCACTTGTCCAGCTGTTGACGGTGATGCAAAC
TTGGCTCCCTTTGATTTGGTCACACCTAATTCTTTCGACAACAATTACTTCAAGAATCTCATACAAAAGAAAGGTCTTCTTGAATCTGATCAAGTTCTTTTTAGCGGAGGCTCCACAGAT
AGCATTGTCCGAGAATATAGCAGGAGTCCTGCAGCTTTCAACTCAGACTTTGCTGCTGCCACGATCAAAATGGGAAATATCAATATTCTCACTGGCACTGCTGGGGAAATAAGGAAGATC
TGCAGTGCTGTGAAC

Retrieve as FASTA