Entry information : MePrx86 ( cassava4.1_025818m)
Entry ID 9141
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-17 (Christophe Dunand)
Peroxidase information: MePrx86 ( cassava4.1_025818m)
Name (synonym) MePrx86 ( cassava4.1_025818m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx86
start..stop
S start..stop
MePrx72 514 0 1..333 1..325
RcPrx23 495 2e-178 1..333 1..326
EgrPrx126 416 3e-147 22..332 19..326
NtPrx06-1B 414 3e-146 7..332 12..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 76416..76652 237 N° 2 76134..76325 192 N° 3 75878..76043 166 N° 4 75233..75636 404
complement(join(75233..75636,75878..76043,76134..76325,76416..76652))


exon

Literature and cross-references MePrx86 ( cassava4.1_025818m)
DNA ref. Phytozome 12:   scaffold09365 (76652..75233)
Protein sequence: MePrx86 ( cassava4.1_025818m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (308)
PWM (Da):   %s   36206.2 (33568.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.95 (5.63) Peptide Signal:   %s   cut: 26 range:26-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGRDSMLLIILSLICSGAFTVCNAVGPRTNGGLKQNFYRTSCPQAELIVSRIMRNRAQSNSALSAKLLRMHFHDCFVRGCDASILLDAVGDTFAEKDTIPNHSLSGYDVIDEIKTELENVCPGVVSCADILALAARDAVSLQFNRPLWAVPTGRRDGNVSLASDIEANLPSPFSDFATLLQLFTNKGLDVNDLVVLSGGHTLGVAHCATFSNRLYNFNGTDGSDPSLDPQYAEFLKTQCPNPFDPATIVEIDPQSSLKFDSNFFNILLQNKGLFQSDAALLQNEQSARIVKQLKISNAFFAKFPISMNKMGAMQVLTGEDGEIRKNCHVIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGTCGAGATTCCATGTTGCTCATCATACTTTCACTTATTTGTTCTGGAGCTTTTACTGTTTGTAATGCCGTTGGGCCAAGAACAAACGGTGGGTTGAAGCAGAATTTCTACCGC
ACAAGTTGCCCACAAGCTGAGCTGATTGTGAGCAGAATCATGAGAAATAGGGCTCAAAGCAACTCAGCTTTGAGTGCTAAACTCTTGAGGATGCACTTTCATGACTGTTTTGTTAGG
GTA
TGTAATTATTATCTCCCATGCATGAAGTTAGTTACATGTTAATCCAGAAAATCAATCAATTATTAACTTTTCTTCTACGTATACTAGGGATGCGATGCATCGATACTGTTAGATGCTGTT
GGAGATACTTTTGCTGAGAAAGACACAATCCCAAATCACTCTCTGTCGGGTTACGATGTCATTGATGAAATTAAGACAGAACTTGAGAATGTTTGTCCTGGAGTAGTTTCATGTGCAGAC
ATTCTAGCTTTGGCTGCTCGTGATGCTGTTTCCCTTCAG
GTAAGGCTCCTGCTGAAAATTAATATATCTTTTTTCTCTTGATATAAATCTGTACACTTAATATAAAAGCACTACTCTATT
GATTGGCAGTTTAATAGGCCTTTGTGGGCAGTTCCAACAGGAAGAAGAGATGGAAATGTTTCTCTTGCATCTGACATTGAGGCTAATCTTCCATCTCCATTCTCAGACTTCGCCACTCTC
TTGCAACTATTTACCAACAAAGGTCTTGATGTTAATGATCTAGTGGTTCTATCAG
GTAGAAACACAAAACCTCTCCGATCTCAGCAAGCATATCATCATATATGTAATCNNNNNNNNNNN
NNNNNNNNNNNCAAACTTGTAATTCATATATCTGTCACTGTGTCAAGCAAAAGTACATTAACTAGAAAAGATGAGGAACATGATCCCAAACATCCGAGTTACATTTGACATAGAAATTGA
CGATCGTGCTATGGCATGAGCACACTGATTCTCAGATTTCTTAATAAATGGTGCAGGTGGACACACATTAGGAGTCGCTCACTGTGCAACTTTCTCAAACAGGCTCTACAACTTCAATGG
CACTGATGGAAGTGATCCTTCTCTAGATCCACAGTATGCAGAATTCTTGAAAACCCAATGCCCTAATCCATTTGATCCAGCAACTATTGTGGAGATAGATCCTCAAAGCTCACTAAAATT
TGATTCTAATTTCTTCAATATCCTTCTCCAAAACAAAGGTCTTTTCCAATCTGATGCTGCACTTCTCCAGAATGAACAATCTGCCAGGATAGTAAAACAACTGAAGATATCCAATGCCTT
TTTCGCCAAGTTTCCTATTTCAATGAATAAAATGGGAGCTATGCAAGTTCTCACTGGAGAAGATGGAGAGATTAGGAAGAATTGCCATGTAATAAATCCT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGTCGAGATTCCATGTTGCTCATCATACTTTCACTTATTTGTTCTGGAGCTTTTACTGTTTGTAATGCCGTTGGGCCAAGAACAAACGGTGGGTTGAAGCAGAATTTCTACCGC
ACAAGTTGCCCACAAGCTGAGCTGATTGTGAGCAGAATCATGAGAAATAGGGCTCAAAGCAACTCAGCTTTGAGTGCTAAACTCTTGAGGATGCACTTTCATGACTGTTTTGTTAGG
GGA
TGCGATGCATCGATACTGTTAGATGCTGTTGGAGATACTTTTGCTGAGAAAGACACAATCCCAAATCACTCTCTGTCGGGTTACGATGTCATTGATGAAATTAAGACAGAACTTGAGAAT
GTTTGTCCTGGAGTAGTTTCATGTGCAGACATTCTAGCTTTGGCTGCTCGTGATGCTGTTTCCCTTCAG
TTTAATAGGCCTTTGTGGGCAGTTCCAACAGGAAGAAGAGATGGAAATGTT
TCTCTTGCATCTGACATTGAGGCTAATCTTCCATCTCCATTCTCAGACTTCGCCACTCTCTTGCAACTATTTACCAACAAAGGTCTTGATGTTAATGATCTAGTGGTTCTATCAG
GTGGA
CACACATTAGGAGTCGCTCACTGTGCAACTTTCTCAAACAGGCTCTACAACTTCAATGGCACTGATGGAAGTGATCCTTCTCTAGATCCACAGTATGCAGAATTCTTGAAAACCCAATGC
CCTAATCCATTTGATCCAGCAACTATTGTGGAGATAGATCCTCAAAGCTCACTAAAATTTGATTCTAATTTCTTCAATATCCTTCTCCAAAACAAAGGTCTTTTCCAATCTGATGCTGCA
CTTCTCCAGAATGAACAATCTGCCAGGATAGTAAAACAACTGAAGATATCCAATGCCTTTTTCGCCAAGTTTCCTATTTCAATGAATAAAATGGGAGCTATGCAAGTTCTCACTGGAGAA
GATGGAGAGATTAGGAAGAATTGCCATGTAATAAATCCT

Retrieve as FASTA