Entry information : MePrx90 ( cassava4.1_026378m)
Entry ID 9145
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2016-01-28 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-28 (Achraf Jemmat)
Peroxidase information: MePrx90 ( cassava4.1_026378m)
Name (synonym) MePrx90 ( cassava4.1_026378m)
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx90
start..stop
S start..stop
RcPrx67 579 0 1..323 1..323
PpePrx62 540 0 1..323 1..324
CclPrx115 532 0 12..323 9..320
EglPrx56 530 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 543375..543593 219 N° 2 543952..544140 189 N° 3 544279..544854 576  
join(543375..543593,543952..544140,544279..544854)


exon

Literature and cross-references MePrx90 ( cassava4.1_026378m)
DNA ref. Phytozome 12:   scaffold11425 (543375..544851)
Protein sequence: MePrx90 ( cassava4.1_026378m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (301)
PWM (Da):   %s   36315.32 (33388.7) Transmb domain:   %s   i2-24o
PI (pH):   %s   8.55 (8.39) Peptide Signal:   %s   cut: 27 range:27-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVFASNLSFLSTFFLLLVLISPAKSRLDAHYYDQTCPQAEKIILDTVQNASMHDPKVPARILRMFFHDCFIRGCDASILLDSTPGNLAEKDGPPNISVRSFYVIDDAKAKLEMACPHTISCADIIAIAARDVVAMSGGPYWNVLKGRKDGRVSKANDTINLPAPTFNVTQLIQSFAKRGLGVKDMVALSGGHTLGFSHCSSFEARLGNFSSVHAIDTSMNREFAVKLRKKCPKSNKDHNAGEFLDSTAATFDNDYYKRLKEGKGVFGSDQALFGDYRTRWIVESFAKDQSLFFREFATSMVKLGNVEVIENEEVRRKCRVVNSYSE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTTTTTGCATCAAACCTTTCATTTTTATCAACATTTTTCCTTCTCCTAGTGCTGATTTCACCAGCAAAATCCAGGCTTGATGCTCATTACTATGATCAAACATGTCCACAAGCT
GAGAAAATTATCTTAGACACAGTTCAAAATGCTTCCATGCATGACCCTAAAGTTCCAGCTCGTATCCTCAGAATGTTTTTCCATGATTGTTTCATAAGG
GTATGACCTCCCTCTTTCTCT
CTTAATCTAGTAAATTGTACTTGCGTGCATCTAATATAAACTCTACCTCACATGAGAATAATCTTAATAATCATTAGAGTAGATGTGTATTTTGAGATTTATGCAAAATTAAGTGTATAT
AATGACTGCATAAATTCTGATGCAAATATTTAATCTAATAGCTGTCAAGTTTTTCATGGTGGCACCCAATGTACTTTCATGCATACACATGCATGATAATTAACTTTGTATGTGCACACA
AACTCCCCCACCATTACATTTGATTTCTCAATATCAAGAAATTAATAACCATATTAATGACAGAATTGGTTGTCATTCAATGGTTATCTATTAATAGGGATGTGATGCATCAATTCTACT
GGATTCAACTCCTGGAAATCTAGCAGAGAAAGATGGCCCTCCCAATATCTCAGTTAGATCCTTCTATGTGATTGATGATGCCAAAGCCAAGCTTGAGATGGCTTGTCCACACACCATTTC
CTGTGCAGATATCATAGCTATAGCAGCAAGAGATGTAGTGGCCATG
GTAATATACCATACGCTCTGCAAAGGCTAAAACTTTATGAAAATTGACAGATCGTATTTGTACCATAGATTGGT
TTCAAAGCATAATTCTCTTTCATTTTTTTCCTCATTATCATCTCTTTCTTGATATTTTCATCAGTCTGGAGGACCTTATTGGAATGTGCTAAAGGGAAGGAAAGATGGAAGGGTGTCAAA
AGCTAACGATACCATTAACCTACCAGCTCCAACTTTCAATGTGACACAACTCATTCAAAGCTTTGCCAAGAGAGGTTTAGGAGTCAAAGACATGGTTGCTTTATCAGGAGGCCATACGCT
TGGCTTTTCACATTGCTCCTCATTTGAAGCTCGGCTTGGCAACTTTAGTTCAGTCCATGCTATTGATACAAGCATGAACAGGGAGTTTGCAGTGAAGCTCAGAAAGAAATGCCCCAAATC
AAACAAGGATCATAATGCAGGAGAGTTCCTAGACTCCACAGCTGCAACTTTTGATAATGATTATTACAAGCGACTCAAGGAAGGAAAAGGTGTGTTTGGATCAGATCAAGCCCTGTTTGG
TGATTACAGGACAAGGTGGATAGTTGAATCCTTTGCAAAGGATCAGAGTTTGTTCTTTAGAGAATTTGCAACTTCAATGGTGAAACTTGGAAATGTTGAGGTAATTGAAAATGAAGAAGT
CCGACGTAAATGTCGAGTGGTTAATTCATATAGTGAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTTTTTGCATCAAACCTTTCATTTTTATCAACATTTTTCCTTCTCCTAGTGCTGATTTCACCAGCAAAATCCAGGCTTGATGCTCATTACTATGATCAAACATGTCCACAAGCT
GAGAAAATTATCTTAGACACAGTTCAAAATGCTTCCATGCATGACCCTAAAGTTCCAGCTCGTATCCTCAGAATGTTTTTCCATGATTGTTTCATAAGG
GGATGTGATGCATCAATTCTA
CTGGATTCAACTCCTGGAAATCTAGCAGAGAAAGATGGCCCTCCCAATATCTCAGTTAGATCCTTCTATGTGATTGATGATGCCAAAGCCAAGCTTGAGATGGCTTGTCCACACACCATT
TCCTGTGCAGATATCATAGCTATAGCAGCAAGAGATGTAGTGGCCATG
TCTGGAGGACCTTATTGGAATGTGCTAAAGGGAAGGAAAGATGGAAGGGTGTCAAAAGCTAACGATACCATT
AACCTACCAGCTCCAACTTTCAATGTGACACAACTCATTCAAAGCTTTGCCAAGAGAGGTTTAGGAGTCAAAGACATGGTTGCTTTATCAGGAGGCCATACGCTTGGCTTTTCACATTGC
TCCTCATTTGAAGCTCGGCTTGGCAACTTTAGTTCAGTCCATGCTATTGATACAAGCATGAACAGGGAGTTTGCAGTGAAGCTCAGAAAGAAATGCCCCAAATCAAACAAGGATCATAAT
GCAGGAGAGTTCCTAGACTCCACAGCTGCAACTTTTGATAATGATTATTACAAGCGACTCAAGGAAGGAAAAGGTGTGTTTGGATCAGATCAAGCCCTGTTTGGTGATTACAGGACAAGG
TGGATAGTTGAATCCTTTGCAAAGGATCAGAGTTTGTTCTTTAGAGAATTTGCAACTTCAATGGTGAAACTTGGAAATGTTGAGGTAATTGAAAATGAAGAAGTCCGACGTAAATGTCGA
GTGGTTAATTCATATAGTGAATGA

Retrieve as FASTA