Entry information : SbPrx129 (Sobic.010G115700.1[2.1] / Sb10g011290[1.4])
Entry ID 915
Creation 2005-12-16 (Christophe Dunand)
Last sequence changes 2011-01-24 (Toky Ramarohetra)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-04-28 (Christophe Dunand)
Peroxidase information: SbPrx129 (Sobic.010G115700.1[2.1] / Sb10g011290[1.4])
Name (synonym) SbPrx129 (Sobic.010G115700.1[2.1] / Sb10g011290[1.4])
Class Class III peroxidase    [Orthogroup: Prx052]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer Nitrogen starvation
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx129
start..stop
S start..stop
SbPrx145 587 0 24..332 21..329
SiPrx31 586 0 5..332 1..328
SbPrx130 584 0 23..332 29..339
SiPrx30 578 0 24..332 21..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16509751..16509981 231 N° 2 16508881..16509648 768  
complement(join(16508881..16509648,16509751..16509981))


exon

Literature and cross-references SbPrx129 (Sobic.010G115700.1[2.1] / Sb10g011290[1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chr10 (16527539..16526442)
EST ref. GenBank:   CF432432
Protein sequence: SbPrx129 (Sobic.010G115700.1[2.1] / Sb10g011290[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (302)
PWM (Da):   %s   35948.25 (32797.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.67 (7.36) Peptide Signal:   %s   cut: 31 range:31-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRSMTIQFCAVLLLPVAFLLFAGSSQVVAQLELGYYSKTCPNVEAIVRAEMEKIISAAPSLAGPLLRLHFHDCFVRGCDASVLLNTTAANVAEMDAIPNRSLRGFGSVERVKAKLEAACPNTVSCADVLTLMARDAVVLAKGPFWPVALGRRDGRVSTATEAADQLPPAYGDIPLLTKIFASKGLDSKDLVVLSGGHTLGTAHCQSYAGRLYNFSSAYNADPSLDTEYADRLRTRCRSIDDKATLSEMDPGSYKTFDTSYYRHVAKRRGLFQSDAALLTDAATRDYVERIATGKFDDVFFKDFSESMIKMGNVGVITGVDGEIRKKCYIVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, intron 1) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCGATCCATGACGATTCAGTTTTGTGCAGTTCTGCTACTGCCTGTGGCCTTCCTCCTCTTCGCAGGTAGCTCACAGGTGGTGGCTCAGCTGGAGCTCGGCTACTACAGCAAGACG
TGCCCGAACGTCGAGGCGATCGTTCGCGCGGAGATGGAGAAGATCATCTCGGCTGCACCCAGCCTTGCTGGCCCCCTCCTCAGGCTTCATTTCCACGACTGCTTCGTCAGG
GTAAATTTG
CTTTTCTGAGTGACGTTTCCAATTAGTAATGACAGCGTGGAACTCTTTTTAAATTACAGAGGTACATAATCATGCAACGTCGAATGACTGCAGGGTTGTGACGCGTCTGTGCTGCTCAAC
ACTACTGCGGCCAACGTGGCAGAGATGGACGCCATTCCGAACAGGAGCCTGCGAGGCTTCGGTTCTGTAGAGAGGGTGAAGGCCAAGCTCGAAGCTGCCTGCCCCAACACGGTTTCCTGC
GCCGACGTTCTCACCCTCATGGCCCGCGACGCCGTTGTGCTGGCCAAGGGCCCCTTCTGGCCGGTCGCGCTCGGGAGGCGAGACGGCAGGGTGTCCACTGCGACTGAGGCGGCTGACCAG
CTACCTCCGGCCTACGGAGACATACCACTGCTCACCAAAATTTTTGCCTCGAAAGGACTCGATAGCAAGGACCTAGTTGTCCTCTCCGGCGGCCACACCCTCGGCACGGCGCACTGCCAG
TCTTACGCCGGCCGGCTCTACAACTTCAGCAGCGCCTACAATGCAGACCCATCCCTGGACACCGAATACGCCGACCGGCTGAGGACGCGCTGCAGGAGCATCGACGACAAGGCTACGCTC
TCGGAGATGGATCCTGGCAGCTACAAGACCTTCGACACCAGCTACTACCGCCACGTCGCCAAGCGCAGGGGGCTCTTCCAGTCTGACGCCGCGCTCCTCACCGACGCCGCCACTAGGGAC
TACGTCGAGCGTATTGCCACCGGCAAGTTTGATGATGTGTTCTTTAAGGACTTCAGCGAGTCCATGATCAAGATGGGCAACGTCGGCGTGATCACCGGTGTTGACGGTGAAATCAGGAAG
AAATGCTACATTGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCGATCCATGACGATTCAGTTTTGTGCAGTTCTGCTACTGCCTGTGGCCTTCCTCCTCTTCGCAGGTAGCTCACAGGTGGTGGCTCAGCTGGAGCTCGGCTACTACAGCAAGACG
TGCCCGAACGTCGAGGCGATCGTTCGCGCGGAGATGGAGAAGATCATCTCGGCTGCACCCAGCCTTGCTGGCCCCCTCCTCAGGCTTCATTTCCACGACTGCTTCGTCAGG
GGTTGTGAC
GCGTCTGTGCTGCTCAACACTACTGCGGCCAACGTGGCAGAGATGGACGCCATTCCGAACAGGAGCCTGCGAGGCTTCGGTTCTGTAGAGAGGGTGAAGGCCAAGCTCGAAGCTGCCTGC
CCCAACACGGTTTCCTGCGCCGACGTTCTCACCCTCATGGCCCGCGACGCCGTTGTGCTGGCCAAGGGCCCCTTCTGGCCGGTCGCGCTCGGGAGGCGAGACGGCAGGGTGTCCACTGCG
ACTGAGGCGGCTGACCAGCTACCTCCGGCCTACGGAGACATACCACTGCTCACCAAAATTTTTGCCTCGAAAGGACTCGATAGCAAGGACCTAGTTGTCCTCTCCGGCGGCCACACCCTC
GGCACGGCGCACTGCCAGTCTTACGCCGGCCGGCTCTACAACTTCAGCAGCGCCTACAATGCAGACCCATCCCTGGACACCGAATACGCCGACCGGCTGAGGACGCGCTGCAGGAGCATC
GACGACAAGGCTACGCTCTCGGAGATGGATCCTGGCAGCTACAAGACCTTCGACACCAGCTACTACCGCCACGTCGCCAAGCGCAGGGGGCTCTTCCAGTCTGACGCCGCGCTCCTCACC
GACGCCGCCACTAGGGACTACGTCGAGCGTATTGCCACCGGCAAGTTTGATGATGTGTTCTTTAAGGACTTCAGCGAGTCCATGATCAAGATGGGCAACGTCGGCGTGATCACCGGTGTT
GACGGTGAAATCAGGAAGAAATGCTACATTGTCAACTAA

Retrieve as FASTA