Entry information : CclAPx02 (clementine0.9_010593m)
Entry ID 9158
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-05 (Qiang Li)
Peroxidase information: CclAPx02 (clementine0.9_010593m)
Name (synonym) CclAPx02 (clementine0.9_010593m)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclAPx02
start..stop
S start..stop
CsAPx05 772 0 1..395 1..393
VvAPx06 676 0 27..395 40..424
GmAPx07 669 0 27..395 54..432
VuAPx03-2 656 0 34..395 47..412
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 150744..150821 78 N° 2 150654..150686 33 N° 3 150427..150561 135 N° 4 150052..150172 121
N° 5 149879..149979 101 N° 6 149707..149794 88 N° 7 148697..148764 68 N° 8 148528..148614 87
N° 9 148289..148363 75 N° 10 148109..148186 78 N° 11 147924..148028 105 N° 12 147356..147421 66
N° 13 146899..147051 153  
complement(join(146899..147051,147356..147421,147924..148028,148109..148186,1482 89..148363,148528..148614,148697..148764,149707..149794,149879..149979,150052..1 50172,150427..150561,150654..150686,150744..150821))


exon

Literature and cross-references CclAPx02 (clementine0.9_010593m)
DNA ref. Phytozome 11:   scaffold_34 (150821..146899)
Protein sequence: CclAPx02 (clementine0.9_010593m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   395
PWM (Da):   %s   42917.91 Transmb domain:   %s   o375-394i
PI (pH):   %s   7.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSLSTAASSRLLCSTTAAAAAAAKKCLRFSPLISQRRSSVNRGYSTVATTKCAASDPDQLKSAREDIRELLKSTFCHPILVRLGWHDAGTYDKNIEEWPRRGGANASLRFEVELKHAANAGLVNALKLIQPIKDKYSGVTYADLFQLASATAIEAGGPKIPMKYGRVDVSGPEQCPEEGRLPAAGPPSPAEHLRNVFYRMGLNDEIVALSGAHTVGRSRPERSGWGKPETKYTKDGPGAPGGQSWTVQWLKFDNSYFKDIKERRDEDLLVLPTDAVLFEDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSNLGAKFDPPEGIVLDDGAAPEKFVAAKYSSGKSELSEAMKQKIRAEYEAVGGSPDTPLRSNYFLNIMIVVAVLALLTSLFGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTCTTTGAGCACCGCCGCTTCTTCTCGCCTTCTTTGCTCCACCACCGCCGCCGCCGCCGCAGCTGCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAAATGCCTCAGATTCTCTCCTCTCATCAGCCAGGTAACTTTTATCGAGTGTGTTTTTTTTATTCTATTTTGTATTTTCTTTTGCCGTAACATGTAGTTTTATCTT
CTTTTTTTTTGGGATTGCAGAGGAGATCGTCTGTGAACAGAGGATATAGCACCGTAGCTACGACGAAATGTGCGGCGTCGGATCCTGATCAGTTGAAGAGTGCTAGAGAAGATATTAGGG
AGCTTCTCAAGTCTACATTTTGCCATCCTATTTTG
GTACATATGCGAATGTGAACCCTCTTTGAATTTCTGAATTGCATTATTGATGTGCTGTCTTTGTTAGTTTGGAGATAGAAGTTTT
GGAATTGAATTTTTGTGAAAACTCAATGTTTAGTTCTATAATTAACATTGCGCAAGAATGAAAAATAAAGCGTATACTGACCAAGTCTAGTTAATGAAATGGAACTATTCAGTAGTTTTA
AGTGTTTACAGCTTCTTGTGTATGATGATATTAATAACAGTAATAACAGGTTCGTCTAGGATGGCATGATGCTGGTACTTATGACAAGAACATTGAGGAGTGGCCTCGAAGGGGAGGAGC
TAATGCAAGTCTTAGATTTGAGGTTGAGCTAAAACACGCAGCCAATGCTG
GTAATGATATGAACATTTTTGTGTAATTGAGCTTGTTTTGAAGATTTGGCACCTCACAACCTTGCATTTC
AGGGCTTGTGAATGCATTGAAACTGATTCAACCTATCAAGGACAAATATTCCGGTGTCACATATGCTGACTTATTCCAGTTGGCTAGCGCTACTGCTATAGAGGTCTGACTGACTCTTAT
TTTGGAATTAATATGATTTCAATTAATTTGATCGACTAAAGGTTCTATCAATTTCTCTGAAATTCAGGAAGCCGGGGGTCCTAAGATCCCAATGAAGTATGGAAGAGTGGATGTCTCAGG
ACCTGAGCAGTGCCCTGAAGAAGGAAGGCTTCCCG
GTAAATACACCTTTGATGTTTATAGAATTTGGCTTGGTATATTTTACCATGGCGCCTACATTAAACAAAATAACAGTTACTGTGC
AGCTGTTTGTATCATGGATTATTCGTAGAAATTTTGTTGATTGATTGCTTGAGCATATGAACTTGTCGTGTCTGGTGTAGGACAATCTTTTCTATGAGAATCTTGTTGATATCTTGGGGA
CTGAGGAGTGTAATTTGGTTAATTCAAAGTTTATCTCTGTTGTTCTTTGATGTAGGAGTGAACTTGTCTTGTCTGGTGTAGGAAAATCTTTTCTATGAGAATCTTGTTGACATCTTGGGG
ACTGAGGAGTGTAATTTGGTTAATTCAAAGTTTATCTCTGTTGTTCTTTGATGTGTGTTTGATAGTATAGAGGCCAAGCAATATTATTCATGGCATGAGGTTTATGTATGTGCTCAGACA
CATGTTTATACATTTGTGTGGATTGAGTGAGAAATATACTTAAGACACTTTGGTGGTTTGAAAAAGNNNNNNNNNNNNNNNNNNNNNNAAGTTGTATATTGAAGGTTTATATCTGCTGAC
ATTTTGGCAATTAATTGCTTAATGTGCTTGCAGCTCCATGACCTTGTCTATTCTCTGATGTATAATTTTGTGAGCATGATATCTACAGTTTTATGGATTAGATGAGTATGAGTAGCTGTT
TCCCCCCATACTGGCGAATTTTGAAGTGTATGGTTGACTTTGTTTATTCTCCGATGTATAATTTTGTCAGTATAATGTCTACTGTTTTATGGATTAGATGAGTATTGAGTAGCTGTTTCC
CCTCATACTGGTGAATTTTGAAGTGTATGGTTGAGTTGTAGTTATTTGTGGTTTTTGTTTTCTTTCCCCTGCTTTTTTTCACACTTCGTCTTAAATGACCACACAACTAAATTTTGAAGT
ACTCATTTGGCATACAGCTGCTGGGCCTCCATCACCTGCTGAACATTTAAGAAATGTCTTTTATAGAATGGGATTAAATGACAAGGTAAGATAAACTGTAGGAATACTTGGTTTTTCTTT
TACCTCAATAGGTTGTGATGTTTATTAAATAGTTCTTTGATCTGCAGGAAATAGTTGCCTTATCTGGTGCACACACAGTGGGAAGGTCTAGACCTGAACGAAGTGGTTGGGGCAAGCCAG
AAACAAAGTACACG
GTAAAAAGCCTCTTTAGTTGTTTGGGAGGTACCATAGAGAACCTTTCTAGTACTTCCTCTGAATTGTTTACTTCTGGATGACTCTACAATCTGATAATTATCTGCT
ACAGAGAATATAGCTATAGCAAGCAGCTAATTATTTAAGAAAATATATTGCATGACAGAAAGATGGACCAGGAGCACCTGGTGGGCAGTCCTGGACGGTACAATGGTTGAAATTTGACAA
CTCCTACTTCAAG
GTTTGAAGTCAGAACACTGTCTCTTCATATGCATCTGCTATAGTGAGAAATAGAGGGGATAAGTAAAAGCATATTCCGCTTGCTGACTGATTTATCTAACAGGATAT
TAAAGAAAGAAGGGACGAAGATTTACTCGTTCTGCCTACTGATGCTGTTCTTTTTGAAGATCCTTCATTCAAG
GTAAATATTAACGAGATCTTAGTGTAAGATGGTGAAGTAGAATCATC
ATTTATAGCTAATAAACTTGGCGTAATTTACAGGTTTATGCTGAGAAATATGCTGAGGATCAGGAAGCATTCTTTAAGGATTATGCTGAAGCCCATGCCAAACTCAGCAACCTTGGGGCA
AAATTTGACCCTCCTGAG
GTATGTTAAGACTGCTTGTGTTAAGTGCTAATGTCAATGCAGCTTTTCTTTTGACCAGAAACACTCTGTCGTTGTTCCTGAAAATTTTGAAAACATCCGGAT
TGAAGAAATTTTTTTATTGTATTTAACTTATGAACTCATATTTTTCTCTTGCGAGATAGTTCAATTGGTTCTGTTATTGGCATTTATTTGAATAATTTTCATAATATTTGGAATAGCTCA
GATGAGTTTTCTTACAAACAAGCATATTTAGAGTGCCAAATAACTGCACATTTATCAATATTGCGTTTCTGGCTGAAAATGCCAAGTGAAATTTTAGTCTTTCTGTACTCTTCGGGCACG
TGCATGACTGCATATTACCGTCTCCAATTATTGGCATCAGCTGACAATCAGGATTTGACTTGTTAACTTTTACGGAATCTGCATCAATAAATCTGTTGTGGAAGATTATGGTAAAAGAGA
TTAGTAATCTTTTAAACTGATTGTTGAATTTGGTGATCAGGGTATCGTGCTAGATGATGGTGCTGCTCCAGAGAAGTTTGTAGCAGCCAAGTATTCGTCCGGAAAGGTTGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCTTTTAGTTAATAGTAGTTGAAAATTCCTTGCATTTTTTATTTCCATAGTAATCGAGCTTGTGTATGTGCAAAATGTTTATCTTTTATACTCTTTATGA
TTTGATGCAGGACTGAAAAAACAAGTAACTTTGTTTTCTTGTGCCGTATGTTATAATAATACAAGATGAAGGTTTTTTGAAATCCTGTGTGTGCTTCACATCTAAAACTTGGAAGTCTAA
GTGAAGGTGAAAGAATAAAATTCAATTAGTGTTGGCTATTTGAATTGCAGAGTGAGCTGTCAGAGGCTATGAAGCAGAAGATACGGGCAGAGTATGAAGCCGTTGGTGGAAGCCCAGATA
CACCTCTACGGTCAAACTATTTCCTGAATATTATGATTGTGGTTGCTGTTTTGGCACTTTTGACATCTCTCTTTGGAAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTCTTTGAGCACCGCCGCTTCTTCTCGCCTTCTTTGCTCCACCACCGCCGCCGCCGCCGCAGCTGCTAAGAAATGCCTCAGATTCTCTCCTCTCATCAGCCAGAGGAGATCG
TCTGTGAACAGAGGATATAGCACCGTAGCTACGACGAAATGTGCGGCGTCGGATCCTGATCAGTTGAAGAGTGCTAGAGAAGATATTAGGGAGCTTCTCAAGTCTACATTTTGCCATCCT
ATTTTG
GTTCGTCTAGGATGGCATGATGCTGGTACTTATGACAAGAACATTGAGGAGTGGCCTCGAAGGGGAGGAGCTAATGCAAGTCTTAGATTTGAGGTTGAGCTAAAACACGCAGCC
AATGCTG
GGCTTGTGAATGCATTGAAACTGATTCAACCTATCAAGGACAAATATTCCGGTGTCACATATGCTGACTTATTCCAGTTGGCTAGCGCTACTGCTATAGAGGAAGCCGGGGGT
CCTAAGATCCCAATGAAGTATGGAAGAGTGGATGTCTCAGGACCTGAGCAGTGCCCTGAAGAAGGAAGGCTTCCCG
CTGCTGGGCCTCCATCACCTGCTGAACATTTAAGAAATGTCTTT
TATAGAATGGGATTAAATGACAAG
GAAATAGTTGCCTTATCTGGTGCACACACAGTGGGAAGGTCTAGACCTGAACGAAGTGGTTGGGGCAAGCCAGAAACAAAGTACACGAAAGATGGA
CCAGGAGCACCTGGTGGGCAGTCCTGGACGGTACAATGGTTGAAATTTGACAACTCCTACTTCAAG
GATATTAAAGAAAGAAGGGACGAAGATTTACTCGTTCTGCCTACTGATGCTGTT
CTTTTTGAAGATCCTTCATTCAAG
GTTTATGCTGAGAAATATGCTGAGGATCAGGAAGCATTCTTTAAGGATTATGCTGAAGCCCATGCCAAACTCAGCAACCTTGGGGCAAAATTTGAC
CCTCCTGAG
GGTATCGTGCTAGATGATGGTGCTGCTCCAGAGAAGTTTGTAGCAGCCAAGTATTCGTCCGGAAAGAGTGAGCTGTCAGAGGCTATGAAGCAGAAGATACGGGCAGAGTAT
GAAGCCGTTGGTGGAAGCCCAGATACACCTCTACGGTCAAACTATTTCCTGAATATTATGATTGTGGTTGCTGTTTTGGCACTTTTGACATCTCTCTTTGGAAATTAG

Retrieve as FASTA