Entry information : CclAPx03 (clementine0.9_017729m)
Entry ID 9159
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-05 (Qiang Li)
Peroxidase information: CclAPx03 (clementine0.9_017729m)
Name (synonym) CclAPx03 (clementine0.9_017729m)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclAPx03
start..stop
S start..stop
CsAPx03 590 0 1..287 1..287
GhAPx01 510 0 1..287 1..288
HaAPx03 509 0 1..287 1..285
RcAPx02 508 0 1..287 1..288
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2353786..2353898 113 N° 2 2353554..2353678 125 N° 3 2352474..2352523 50 N° 4 2352023..2352088 66
N° 5 2351889..2351937 49 N° 6 2350984..2351066 83 N° 7 2350602..2350681 80 N° 8 2350393..2350495 103
N° 9 2349327..2349521 195  
complement(join(2349327..2349521,2350393..2350495,2350602..2350681,2350984..2351 066,2351889..2351937,2352023..2352088,2352474..2352523,2353554..2353678,2353786. .2353898))


exon

Literature and cross-references CclAPx03 (clementine0.9_017729m)
DNA ref. Phytozome 12:   scaffold_26 (2353898..2349327)
Protein sequence: CclAPx03 (clementine0.9_017729m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   287
PWM (Da):   %s   31626.17 Transmb domain:   %s   o258-280i
PI (pH):   %s   6.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPVVDTEYLKEIDKARRDLRALIAYKNCAPIMLRLAWHDAGTYDVNTKTGGPNGSIRNEEEYSHGSNNGLKIALDFEEVKAKHPKITYADLYLAGVVAVEVTGGPTVDFVPGRKDSKISPKEGRLPDAKRGAPHLRDIFYRMGLSDKDIVALSGGHTGRAHPERSGFEGPWTREPLKFDNSYFVELLNGESEGLLQLPTDKALLEDPEFRRYVELYADEDAFFRDYAASHKKLSELGFSPGSGSKSTANDCTILAQGAVGVAVTVAVVILSYFYEVRKRMK*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTACCGGTCGTTGACACAGAGTACCTGAAGGAGATCGACAAGGCTCGTCGCGATCTCCGCGCTCTTATCGCTTACAAGAACTGTGCTCCAATCATGCTCCGTCTAGCGTGCGTT
CTCTACTCTCTTTCCTTTCCTGTTTGTTTCCCGAGGAAACGCTTGCTCAAGAAAGTCATTGAAACTTAATTCATGTTTGTTTTATTTTTTTTTAATAAAGGTGGCACGACGCGGGAACAT
ATGACGTGAACACGAAGACTGGTGGACCAAATGGCTCGATAAGGAACGAAGAGGAGTACTCTCATGGCTCCAACAATGGCTTGAAAATCGCTCTTGATTTTTGTG
GTGAGCCTTTTTTAT
TAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAAGTCATGCACTTGTGAATATCGAAAAGTAGAAAATAGATAGCATAAAATGAATTAAA
TATAACGTCCACTATGTGGTGATTGTGGAGCTGACAAAAAAGCTGCAATTATAATTGAGAAAATTTGCAATATTAATATTTGACTGTTTCAGTCGCATTGACATTGAGTAAACTAGAATC
TCAGTGAAACTATTGCTTGGCATGAAATTTATGTGATCACACTTTTGACTTTTAGACTTATCAAGCATTTCAGAGAGTTTAAGCCTTTAGTTTGGATGGTGAGTTTCCTGCTACACTTGC
ATTCTTTACCAAAATTAGGTGTCACCCAGTTGCATGCTTGAGTTGAAAACCAAGGTTGAATGGTGATTACATAAGTATATCATATAGACATATACCATTTTTACTAAAAAGCACAATGGA
CGATGGTCAATTAAAATGAAAGAGTGATTTGTCAATCTAATGATATGAGCACCGGCGGACATGTTAATCCATATAATCTCCATGAATTGAAGAACATTCTTGTCTTCAGTATATCCTAAG
AACACAGGTATTTTGATCACTCCTTAAACCATATATAGTACTTAGACACTACTATCATCTGGTCACATTTGATTATTTACTCATTTTTAAATGCAAATAATTTCATTTGATGTCTAATTT
ATTTTGAGGCTAGACATATACATGTTATCAGATGATAATGATTATACAGAAAGAATTGTCCTATGATGGTCTTCTTCATGGGACCTCTGAACTGTTGTTCTTGGCTTATTTTGTGATTTT
TTTTTTTTTTTGGAAAAACCAGTCTGATAGATATGGGACATTGCTAACTTCATGAGAATGATTGCGATTTAAGAATTTATCAGTTAATTATATCTGAGAACCCTGGAATAATTTATAGCT
TAGATTAACTTGACATGGACTTGTCAGTGAAATGGTTTTCTTTTCCTTATGCCAGAGGAAGTGAAGGCTAAACATCCAAAAATAACATATGCAGACCTATACCAGGTGAGTACAAAGTTG
AAATAGTTTGTATGCCAATTCTGTCGACATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAAGTAGGATGGGAGGTTATTGTTACACTTAACAGTTATACATAAAGGGATGT
ATATCTTGACACAAACTGCAGTAAATAGTGGATTTTGTTATGCTGTTAACTACTGATGTGGACATTATGGCCAGATCTATATATCAGCTTAAGGGACATCCCGAGGCTGGGGTATGTGGG
GAAATAACGTAAAATGGTTTTGTATGACAAATCAGAGCAATTTTTGTGGATTTTACCTGAAGTTGACAACTTAATTAGAAGATGCTAGATGCACTCTTTGTTCATATCTAATAATTACTT
GTTATTCTAGCTTGCGGGTGTTGTTGCAGTTGAGGTCACTGGAGGTCCTACAGTCGACTTTGTTCCTGGTAGAAAGGTACTATGTTGTGACTTTTTGAAATTATAGCTTTTATGTTCAAT
CACTTCAATTGATTGCTCGCCCTTTTTTTTTTTTTCTTTAGGATTCAAAAATTTCTCCCAAGGAAGGGCGTCTTCCAGATGCCAAACGAGGTATCTTGCTGGTTTATTGTATTATAACCT
CTTGGAATCTTGAAGCAGTGTGTTAATGTCAAATATTTAAAATTCTGGAATGCTTGATACTGTTCTTGAATTACTAATATAACTTCTAGCAATGTGCTCCTGAAGCTTGTTCATTAGTAT
TTTTAATTTGATTAGATGAACATTGCTGTTATCTAATCTTGTTATTTGCCCCAATTTGATAGAGAAGAAGAAATTGAAATAATTTGCGCTAGTTTAAATTTAAACTTTTAATTTTAACTT
CTCCATATCTGCCTGGTGTCTATTATATGATTGAGGTTATCATCACTTATTTATGGTTCATAGATTGTAGGAGTACATTATATATCTGGTGAATATTTTTGTATAGAATAAAAATGTCTT
AGGGTATACTCTTTTCTGGGGTTGTAGTATATGCCATGCCTTGATTGCATATGAGTTAATGTCTTAAAACAAATCCATATGTCTCAGCCTCCTCTTCAAGTGTCAGCTTAGCTTTACTGT
AAACTATTACTGATGGAAAATTAGCATGGGCTAATTCATGAAGGAAATTCAAAAGCAGGCTTATAGAACCCTCAGAAATGAAGATGTGTCAGTTGAAATGATATGTTCTTGAAAGATTAG
TTCCAATAGGCTATAGCTACTCAGCCTACTCTATTTGAAATGATATGTTAATTAAGATTCAGTGCACTATAGTTTTTATTTTAAAGCAGGGATATAGTCAAGTTACTGTCCATATCCCTA
ATTTAAAGTGCTCATATATAATACTGTCTGGGAGATAACTTTAATATAACGCCTTGTAAATTTGGGTGGTAGGTGCACCTCATCTGAGGGATATCTTTTATCGGATGGGTCTGTCTGACA
AGGATATAGTGGCACTCTCAGGGGGCCATACTTTG
GTAACTCTCTCGACACATTATATATGTAGTTCTTATCTTATGCAGACGTCTACATCTTTTTAAAATACAGATGGAGTTAAAGGGC
AAAAAGTAGGAAAGAGAAAAAAGAAAGCATGAACTCCAATGTAATATGGACGATGAGTTATGATTTGTAATTCTTTTATTGTCTTTTATCTCCATCCGCAATTTAATAGGATGTAGACAT
CCTTAAAGAAATGCACTCAACATGCTTGTACCAATATCTGAGACTGTGTATTGTGGATACTTGAAAGTGAACATTTTTGTTTGGCGCCGTGGCATAGGGAAGGGCACATCCAGAGAGATC
AGGTTTTGAAGGCCCTTGGACCAGGGAGCCTCTGAAATTTGATAACTCATACTTTGT
GTAAGATTTGAACTGAGCTTGGAAAAATATTTCCTGCCTTATCTTTGTAGTGGGAGTCATTTA
GAGTATCACACAATTAATTTTTCATGATTACTGTTGATTCCAGGGAGTTGCTGAATGGGGAATCAGAAGGATTACTGCAACTTCCAACAGACAAGGCTTTATTAGAAGACCCTGAGTTCC
GTCGTTATGTTGAGTTGTATGCAAAG
GTCAATGCACTTATCTTAACCAAATAACCCCATGTTAACAGCGCTTCATTTGATCACGCAGTATATTTATTTCTGGCTGACAAGACCTTTACTG
TGTTTTCCTTTTGCTGCTGCATGCAAAATATCATGGGATGATCTTATAATATAGTTTCTAGTTCTGTTACTTTTTCCCGTAGAATCAGTTTTTTCTTTTTGCTTAACAAGGCCCACCTAT
GCATCCATAGAGATTGGTAGAATCTGAGCAGACAGAGCAGACATTGATCTGCCAACTCAGTTTGGTGGTGAGCCATTAGTCATGGGCAATCTAACCTAAACTCAGCCTGTCTACTTGTGG
GTTCAGTTTGGATAGAGACGGGGTTGGCGTACCTGAAGCCTGGCTGGCAGTACTTTTCCTGTTGTTGTCTCACATTTATATCTTAGACACTTCCATAATTTTTTAAAGTAGATTCGAAGT
GTGGTGTTAGGTTGTTTGTTTGGAAATTAGCTGGGTCAGGGTTGTGGAGTTTTGAACTGGCTCAGTGCCGGTTCTTGCCACGATTAGCACCACATCTGGTTGATGTGACCATCTTAGAAG
CTAGAACTGGAATGTTTTGTGCCTAATAAATTGGGTCCCTGACAGAAACCCAACCATTATCCAACTCCAGAGTCTTACAAGTTTGATCAAACTTGTTGGGTGGATTTCTGTGGTCTTTTA
TTATCAAGTTGTCCTCGAATGACTATAAGCTTTCGCAATTTAGTATCTTTTTAGATCTTTACAATTGCAAATATAATTTGTTACTTGATCTGGTTTCCACAGTTACTTATTCGTTTATAA
CTGTCTTTATTGGATGTGATTTTCCACTTATTTTACCAAATTTCTGGCCCATGTCAGGATGAGGATGCATTCTTTAGAGATTATGCAGCATCACATAAGAAACTTTCAGAGCTAGGGTTT
TCACCCGGTTCTGGCTCCAAATCAACAGCAAATGATTGCACCATATTAGCTCAAGGTGCAGTTGGAGTAGCAGTTACTGTGGCAGTGGTGATTCTAAGCTACTTTTACGAAGTTCGCAAA
AGGATGAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTACCGGTCGTTGACACAGAGTACCTGAAGGAGATCGACAAGGCTCGTCGCGATCTCCGCGCTCTTATCGCTTACAAGAACTGTGCTCCAATCATGCTCCGTCTAGCGTGGCAC
GACGCGGGAACATATGACGTGAACACGAAGACTGGTGGACCAAATGGCTCGATAAGGAACGAAGAGGAGTACTCTCATGGCTCCAACAATGGCTTGAAAATCGCTCTTGATTTTTGTG
AG
GAAGTGAAGGCTAAACATCCAAAAATAACATATGCAGACCTATACCAG
CTTGCGGGTGTTGTTGCAGTTGAGGTCACTGGAGGTCCTACAGTCGACTTTGTTCCTGGTAGAAAGGATTCA
AAAATTTCTCCCAAGGAAGGGCGTCTTCCAGATGCCAAACGAG
GTGCACCTCATCTGAGGGATATCTTTTATCGGATGGGTCTGTCTGACAAGGATATAGTGGCACTCTCAGGGGGCCAT
ACTTTG
GGAAGGGCACATCCAGAGAGATCAGGTTTTGAAGGCCCTTGGACCAGGGAGCCTCTGAAATTTGATAACTCATACTTTGTGGAGTTGCTGAATGGGGAATCAGAAGGATTACTG
CAACTTCCAACAGACAAGGCTTTATTAGAAGACCCTGAGTTCCGTCGTTATGTTGAGTTGTATGCAAAG
GATGAGGATGCATTCTTTAGAGATTATGCAGCATCACATAAGAAACTTTCA
GAGCTAGGGTTTTCACCCGGTTCTGGCTCCAAATCAACAGCAAATGATTGCACCATATTAGCTCAAGGTGCAGTTGGAGTAGCAGTTACTGTGGCAGTGGTGATTCTAAGCTACTTTTAC
GAAGTTCGCAAAAGGATGAAGTGA

Retrieve as FASTA