Entry information : CclAPx06 (clementine0.9_017635m)
Entry ID 9162
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclAPx06 (clementine0.9_017635m)
Name (synonym) CclAPx06 (clementine0.9_017635m)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclAPx06
start..stop
S start..stop
CsAPx04 586 0 1..289 1..289
CroAPx03 474 1e-171 1..287 1..289
LeAPx06 468 4e-169 7..289 6..288
BnAPx03-1Aa_other 467 1e-168 7..289 6..287
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2875548..2875663 116 N° 2 2875291..2875415 125 N° 3 2875142..2875191 50 N° 4 2874892..2874957 66
N° 5 2874762..2874810 49 N° 6 2874211..2874293 83 N° 7 2874027..2874106 80 N° 8 2873802..2873904 103
N° 9 2873519..2873716 198  
complement(join(2873519..2873716,2873802..2873904,2874027..2874106,2874211..2874 293,2874762..2874810,2874892..2874957,2875142..2875191,2875291..2875415,2875548. .2875663))


exon

Literature and cross-references CclAPx06 (clementine0.9_017635m)
DNA ref. Phytozome 11:   scaffold_25 (2875663..2873519)
Protein sequence: CclAPx06 (clementine0.9_017635m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   289
PWM (Da):   %s   31637.12 Transmb domain:   %s   o260-282i
PI (pH):   %s   6.25
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVGSIAIDAEYLKEIEKARRDLRSLISSRSCAPIMLRLAWHDAGTYDAKTRTGGPDGSIRHEQEYAHNANNGLKIAIDLEGVKAKHPRITYADLYLAGVVAVEVTGGPAIDFAPGRKDSSESPEEGRLPDAAQGVSHLRDIFYRMGLSDKDIVALSGGHTGRAHPERSGYEGPWTKEPLKFDNSYFVELLKGESEGLLKLPTDKALLEDPMFRYYVELYADEDAFFTDYAASHKKLSELGFNPPSLGFKDAVKNTALLAQSAVGVAVAAAVVIFSYFYEVHRKTK*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGGAAGCATCGCAATTGATGCAGAGTACTTGAAGGAAATCGAGAAGGCTCGTCGAGACCTTCGCAGTCTCATCTCCAGCAGAAGCTGCGCTCCTATCATGCTTCGCTTGGCGTAC
GTAATATTCTTGCTTTCTTTCTTTTTGGCACTTTCTTTGGTTGACTTGAGAGTAATATCAACGTGCAAGTTTCCTAAAATTAAGCGTCGAGTTTGTTGCATGTTTCATGGATGAATGGTA
CCGTACAGGTGGCACGATGCTGGAACTTATGATGCGAAGACAAGGACGGGCGGACCTGATGGCTCCATCAGGCACGAGCAGGAGTACGCTCATAATGCTAACAATGGTTTGAAGATTGCT
ATTGATTTATGTG
GTGAGCTTTTAACTATTACAGCTCGCAACAGGTTTTTGCTAATAAGTTTGTTCAATATGTTTTGTAATTTTTTGTTTCTGGGCTCTGTTTTGGTAACAGAGGGGGTG
AAGGCCAAGCATCCAAGGATTACGTATGCTGATCTTTACCAG
GTATTCTTTTTTTCTTTTTTCTTTTTTAAAGCAAATTATGTATAGAAACTAGTATCGAAGGTAACTGGTTGATGTAAA
TAACTATTACTAACTGAATATAATTGGCTAGCTTGTGACAAGAAGAAATCATTTAGTACCTCATGAAATCCTTTACTTTTGAACTGTATTCTTTTTGCATTCTTAGCTAGCGGGAGTTGT
TGCGGTTGAGGTCACTGGAGGACCTGCTATTGACTTCGCTCCTGGAAGAAAG
GTAATGTTAGAGGAGAGAGATATCAAATTACTTATTGATTACATTGTTCTTTCTCATTACTAATCCTG
TTTATTTCTTCAGGACTCGTCAGAATCTCCTGAAGAAGGGCGTCTTCCTGATGCCGCTCAAGGTTTGTCGTTCAGATTATTTAATTATTTGCACTTATTTCTGTTAATTAAATTTCTCAA
AACATTCATGTTTAGCTTTCCTTTTGAATTTCATGGATACCACTTGCATGTGTCAAGTTTAGATAAGAGAGAACTGGGTTAGACTAGATAGGTCCCTTTCTCTGTTTTCTATCATGTGTC
CTCAAACCAGTCTTTTAAATTTTCAATCATCATTAACTGGGGTGCTTTCCAGCCCTGAAAATCCAATCTGCATGAACACTCATCCTTTGACACTTCTGCTTATCTGATATCAGATGCAAG
TTTCCCCCAAAATTTAACATGTTCTTGGTGTTGGAAATTTTGATTATGACAAGCCCTGTAAGCAGTAGACTTAAGAATATGTAATAGTTTCTATTATTGCTGACAATAGTTTCAGTTGCA
CATTCAATGGTTAATAGACTATACTCTCTTTATATAAAACTATTTTCCAGGTGTATCCCATCTGAGGGACATCTTTTATCGGATGGGTCTATCTGATAAGGACATTGTGGCACTGTCTGG
AGGCCACACACTG
GTAACTCTTATCCCTAATTCAACTGTTTGGTTAATTCTCTGCTATGATTATTAATTGTACAATTTTTTTTTTTTTTAAGAAATTTCTTCATTTATTTTTTGTAGGGA
AGAGCACATCCGGAAAGGTCTGGTTATGAGGGACCCTGGACAAAGGAGCCTTTAAAATTCGACAACTCTTACTTTGT
GTATGTTAAATTCTTTGACGGTTTCATATCTAGTTGACTTTCA
TTTATTCATTATAAAGCAGTTCAGATACACTTGTACACATGTTATATATGCATCATTGACCTACTAATATGGTGATCAGGGAGCTTCTGAAAGGGGAATCAGAGGGATTGTTAAAGCTTC
CCACGGACAAGGCTCTACTGGAGGATCCTATGTTCCGCTACTACGTGGAGCTATATGCAAAG
GTGATGAAATTCTGGAAATTACCTTGCGCCTTGTGATCTTTCTAAACTTTGGGTGGTT
TTCAATCTTTTTACATTTTTATGGCAGGATGAGGATGCATTCTTCACAGATTATGCTGCTTCACACAAGAAACTTTCAGAGCTAGGCTTCAATCCACCTTCCTTGGGTTTTAAGGATGCT
GTGAAGAACACTGCATTGTTGGCACAAAGTGCTGTCGGAGTCGCTGTTGCTGCAGCTGTAGTGATTTTCAGTTACTTTTATGAAGTTCACAGAAAAACCAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGGAAGCATCGCAATTGATGCAGAGTACTTGAAGGAAATCGAGAAGGCTCGTCGAGACCTTCGCAGTCTCATCTCCAGCAGAAGCTGCGCTCCTATCATGCTTCGCTTGGCGTGG
CACGATGCTGGAACTTATGATGCGAAGACAAGGACGGGCGGACCTGATGGCTCCATCAGGCACGAGCAGGAGTACGCTCATAATGCTAACAATGGTTTGAAGATTGCTATTGATTTATGT
G
AGGGGGTGAAGGCCAAGCATCCAAGGATTACGTATGCTGATCTTTACCAGCTAGCGGGAGTTGTTGCGGTTGAGGTCACTGGAGGACCTGCTATTGACTTCGCTCCTGGAAGAAAGGAC
TCGTCAGAATCTCCTGAAGAAGGGCGTCTTCCTGATGCCGCTCAAG
GTGTATCCCATCTGAGGGACATCTTTTATCGGATGGGTCTATCTGATAAGGACATTGTGGCACTGTCTGGAGGC
CACACACTG
GGAAGAGCACATCCGGAAAGGTCTGGTTATGAGGGACCCTGGACAAAGGAGCCTTTAAAATTCGACAACTCTTACTTTGTGGAGCTTCTGAAAGGGGAATCAGAGGGATTG
TTAAAGCTTCCCACGGACAAGGCTCTACTGGAGGATCCTATGTTCCGCTACTACGTGGAGCTATATGCAAAG
GATGAGGATGCATTCTTCACAGATTATGCTGCTTCACACAAGAAACTT
TCAGAGCTAGGCTTCAATCCACCTTCCTTGGGTTTTAAGGATGCTGTGAAGAACACTGCATTGTTGGCACAAAGTGCTGTCGGAGTCGCTGTTGCTGCAGCTGTAGTGATTTTCAGTTAC
TTTTATGAAGTTCACAGAAAAACCAAGTAA

Retrieve as FASTA