Entry information : MguAPx02 (mgv1a012399m)
Entry ID 9163
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-07 (Christophe Dunand)
Peroxidase information: MguAPx02 (mgv1a012399m)
Name (synonym) MguAPx02 (mgv1a012399m)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguAPx02
start..stop
S start..stop
RgAPx01 480 4e-175 1..250 1..250
NtAPx03-1B 470 5e-171 1..250 1..250
StAPx02 467 8e-170 1..250 1..250
CroAPx01 466 2e-169 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1644121..1644239 119 N° 2 1643217..1643391 175 N° 3 1643060..1643125 66 N° 4 1642872..1642920 49
N° 5 1642673..1642758 86 N° 6 1642508..1642587 80 N° 7 1642294..1642396 103 N° 8 1642145..1642203 59
N° 9 1642012..1642027 16  
complement(join(1642012..1642027,1642145..1642203,1642294..1642396,1642508..1642 587,1642673..1642758,1642872..1642920,1643060..1643125,1643217..1643391,1644121. .1644239))


exon

Literature and cross-references MguAPx02 (mgv1a012399m)
DNA ref. Phytozome 12:   scaffold_2 (1644239..1642012)
Protein sequence: MguAPx02 (mgv1a012399m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   251
PWM (Da):   %s   27404.9  
PI (pH):   %s   5.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVKNYPTVSEEYLKAVEKAKKKLRGLIAEKNCAPIMLRLAWHSAGTFDQCSRTGGPFGTMRFDAELAHGANSGLDIALRLLAPIREQFPTISYADFYLAGVVAVEVTGGPEVPFHPGRPDKAEPPVEGRLPDATKGSDHLRDVFVKQMGLTDQDIVALSGGHTGRCHKERSGFEGPWTENPLIFDNSYFKELLSGEKEGLLQLPSDKALLADPSFRPIVEKYADEDAFFADYAEAHLKLSELGFAEA

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAGAACTACCCAACTGTGAGTGAGGAGTACCTCAAGGCCGTCGAGAAAGCTAAGAAGAAGCTCAGAGGATTGATCGCCGAGAAGAACTGTGCTCCTATCATGCTCCGCCTTGCG
TAAGTTTTCCTCAATTTTTTTTTGATACTGTTTAACCATTGATTGGATAAAATGTTGTAAACTAATCATCATTTTCACATCCGTTGATTTTTCTTTTTCTATTCCGCCATTAGATCTGGG
AAAATATTGATATATTATTGCGCGGATCAGTCCATGGCTTCAATTTATTTTAAATACACAGACACTTGCAATTTAGATAATAAATCGNNNNNNNNNNNNNNNNNNNNNCTGTGAACGAGA
GAAAAATTCAACGATCGAATTGATGTGATTTTTGTATAAGTCTAAGTGTTATATCCGTTTCCTATACATGAATGTTACACTTGACCTGAACAGAGGTGAAACTACTGCTGATGAGTAATA
TATAAGGCTATGAGGTTAACTTGGATCTGTTTATTAGCCTGTGTTACGATTAAAATATTCAAAGTACTTGTATCAATTAAGTTGTTCCGGTTATTTTGCCAAGTTTAGTTAAGTCTTCCT
TTTGGTAATTACGTTAAAGTTATCTAGGAGTTTTATTTGTCCTTGCGATGAGCCATCGAGCCTGGTCTTCAAACATGTGGTTAGATTGATATTGATGATTTCAGTGCTATTTATCTTTTT
TGGGTTATAGACTGGTGCAACTAAGGCATATAATTCTTCTTTAATTGTATTGAATCATATTCCAAGTGAGTTGATTGTGCTCCAATCTTGATTTTTAATCCTTAAAATATGATGTTTTGT
GATTGCAGATGGCACTCTGCTGGTACATTTGATCAGTGCAGCAGAACTGGAGGTCCCTTCGGAACCATGAGGTTCGATGCTGAGCTGGCACATGGTGCAAACAGCGGTCTCGACATCGCT
TTGAGGCTCTTGGCGCCCATCAGGGAGCAATTCCCGACCATTTCTTATGCTGATTTCTATCAG
GTATTGTTGTCTTTATGTGCATTTTTATACTTCAGCATTGTACAACTGTTGTTAGTA
AATGTGTAACGTTTGTCTTTTTTATTGTACTCAGTTGGCTGGAGTTGTTGCTGTTGAAGTTACTGGAGGACCTGAAGTCCCATTCCACCCAGGAAGGCCGGTTAGTGAAAGCTGTCTTTG
CTTTACTTTTGTTACATTTTCTTGTAATGTTATTCCTTGTATATTTCCATATGACAAGAATGTTCAATAATTTCGGAAATGTAATTTGCTGAGAAATGGTTCATGATCTAAAATTTCAGG
ACAAGGCTGAGCCACCTGTTGAAGGTCGTCTGCCTGATGCTACCAAGG
GTAAGACACGTGAACATTCACTCATTGATAGTTTTTGTCGAGGATCAACTATATCATAGTTCGAGTTTCCCT
TATGCTTTCTTGCAAATATTTATCTGCAACTGTTATTACAGGATCCGACCATCTGAGGGATGTTTTTGTCAAACAAATGGGTCTGACCGACCAGGATATTGTTGCTCTCTCTGGTGGCCA
CACTCTG
GTTTGTGTTTGCTATTATCTTCTGGTTTCCGAGATAGTACAAGAAGTTGTATGTACTCAAAAGATTTTATTTGTATTTGATACAGGGAAGATGCCACAAGGAACGTTCAGGAT
TTGAGGGACCATGGACCGAAAACCCTCTCATCTTTGACAACTCTTACTTCAA
GTAAGACCACCATTATGACTCTAATATTACAATGTTGCAATTATTTATTCTTGTGTGAAAATATCTGC
TTCTGTTGTGTCATAATTTGTTTCGTTTTTTGATTGTGAACAGGGAGCTTCTGAGTGGAGAGAAAGAAGGTCTCTTGCAGTTGCCATCAGACAAGGCTCTTCTTGCTGATCCTTCATTCC
GCCCTATTGTTGAGAAATACGCTGCG
GTCAGTAAATCTTCGTTTTTATTTGTCCACATTTGTCTATTATATAATATGTTTGTATCTTTACTAACGAATAGTTATTGTGTTATATAGGATG
AGGATGCCTTCTTTGCAGACTATGCTGAGGCTCACTTGAAGCTATCTGAGTTGGG
GTAAGCCTTTCTTTCCAGTTTTTTCTTGCTCTCTCTATTATTATTGTAGTATTTCTCATAATGTT
GTCCGTGTGAAGGTTTGTACTAATCTTTTTGAATCTCGCCTTGGATTTGCAGATTTGCTGAAGCCTGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAGAACTACCCAACTGTGAGTGAGGAGTACCTCAAGGCCGTCGAGAAAGCTAAGAAGAAGCTCAGAGGATTGATCGCCGAGAAGAACTGTGCTCCTATCATGCTCCGCCTTGCA
TGGCACTCTGCTGGTACATTTGATCAGTGCAGCAGAACTGGAGGTCCCTTCGGAACCATGAGGTTCGATGCTGAGCTGGCACATGGTGCAAACAGCGGTCTCGACATCGCTTTGAGGCTC
TTGGCGCCCATCAGGGAGCAATTCCCGACCATTTCTTATGCTGATTTCTATCAG
TTGGCTGGAGTTGTTGCTGTTGAAGTTACTGGAGGACCTGAAGTCCCATTCCACCCAGGAAGGCCG
GACAAGGCTGAGCCACCTGTTGAAGGTCGTCTGCCTGATGCTACCAAGGGATCCGACCATCTGAGGGATGTTTTTGTCAAACAAATGGGTCTGACCGACCAGGATATTGTTGCTCTCTCT
GGTGGCCACACTCTG
GGAAGATGCCACAAGGAACGTTCAGGATTTGAGGGACCATGGACCGAAAACCCTCTCATCTTTGACAACTCTTACTTCAAGGAGCTTCTGAGTGGAGAGAAAGAA
GGTCTCTTGCAGTTGCCATCAGACAAGGCTCTTCTTGCTGATCCTTCATTCCGCCCTATTGTTGAGAAATACGCTGCG
GATGAGGATGCCTTCTTTGCAGACTATGCTGAGGCTCACTTG
AAGCTATCTGAGTTGGG
ATTTGCTGAAGCCTGC

Retrieve as FASTA