Entry information : MguAPx04 (mgv1a012445m)
Entry ID 9164
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-07 (Christophe Dunand)
Peroxidase information: MguAPx04 (mgv1a012445m)
Name (synonym) MguAPx04 (mgv1a012445m)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguAPx04
start..stop
S start..stop
CroAPx01 463 2e-168 1..250 1..250
SaAPx04 460 4e-167 1..250 1..250
RgAPx01 458 3e-166 1..250 1..250
NtAPx03-1A_unknown 457 4e-166 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 645720..645838 119 N° 2 644923..645097 175 N° 3 644764..644829 66 N° 4 644253..644301 49
N° 5 644036..644121 86 N° 6 643849..643928 80 N° 7 643610..643712 103 N° 8 643445..643503 59
N° 9 643350..643362 13  
complement(join(643350..643362,643445..643503,643610..643712,643849..643928,6440 36..644121,644253..644301,644764..644829,644923..645097,645720..645838))


exon

Literature and cross-references MguAPx04 (mgv1a012445m)
DNA ref. Phytozome 12:   scaffold_85 (645838..643350)
Protein sequence: MguAPx04 (mgv1a012445m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27293.74  
PI (pH):   %s   6.09
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVKNYPAVSEEYLKAVDKCKKKLRGFIAEKNCAPLMLRLAWHSAGTFDQGSKTGGPFGTMRFKAEQGHGANNGIHIAINLLEPIKEQFPILSYADFYLAGVVAVEITGGPEVPFHPGRQDKEEPPIEGRLPDATKGCDHLRDVFGKQMGLSDQDIVALSGGHTGRCHKERSGFDGPWTPNPLIFDNSYFTVLLGGDKEGLLMLPSDKALLSDPVFRPLVEKYADEDAFFADYAVAHMKLSELGFAE

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAGAATTACCCAGCTGTGAGTGAAGAGTACCTGAAGGCTGTAGATAAATGTAAGAAGAAGCTCAGAGGGTTTATCGCTGAGAAGAACTGCGCTCCTCTCATGCTCCGCCTTGCG
TGAGTTTTTTGCGCCTCCGNNNNNNNNNNNNNNNNNNNNNNNGTTGTTTTTACGTTTTAATTTTGTGGATTTTGAATTTTTGATTGATATTGAATGATTTGTTTATGATAATGGTATAGT
GATTTGATCTGTGGAGCACATTAAATGATGATCATCGTCGTTATGTTATTTTATTCGAATGTATTTGTTTTCTATCCTTTTTACATCTATTAAATTGATGCATGTGATATTTAGAGAAGC
ATAATTAATTTGACTTGAGTATATATGGCTTATATGAGTGATCCGATTTATGGCTTTGAGTCTAGTGCTGTGCCGATGATTGCGGATGATTTTCTAGTGATTCTGATCTGTAGAGTAAGG
AAACACGTTCTTCGGATGATGCACGAGTAATTTTACAATATCATTTGAATACAATTATTCATCGTCTATTTTAGAATCTTAAACTATTACGAACATATACGTTTTCTTTCTTTTTTACAT
TTGAAAAATACAACATGCGACGTAATCTACCAACGAAAGCATGATATAAAAAAGATTTGACCGAGATTTGAGATCTATTATGCCTCAGTAATATGTTTTTTATTTTATTTTTATCATCTC
ATCTCAGTAATATGATTGTAGGTGGCACTCTGCTGGTACATTTGACCAAGGCAGCAAAACCGGAGGTCCATTTGGGACAATGAGATTCAAAGCTGAGCAGGGACACGGTGCTAACAATGG
TATCCACATTGCTATTAATCTTTTGGAGCCCATCAAGGAACAGTTCCCCATACTTTCTTATGCCGATTTCTATCAG
GTAATTTTATTTATTTACTTTTATTTCGTTCAAGAATATATTTC
ACGTTTGCATGGAGTTGAAAAAAATTTGGTGTCGTTTTGCTCGTCACAGTTGGCTGGTGTTGTTGCTGTTGAAATAACTGGAGGGCCTGAAGTTCCATTTCACCCTGGGAGGCAGGTTGG
TGAATATTCCCCTTTTTCCTTCCTTAATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATCGTGCTTTGAAATCTATGTTAACTTGTACTGTGAAACTGTGGTGGTGTTGAGCATCA
AATGAGCGTTACTACTTAGTGTAATGTTATTTCTTTATCATGTATGAAGTGAGGGAAGGATCGTTTGTGTAGGTAGTCATTTTGAGTGTTCTGTCTAAATGGAGGGTTTTTCTTAAAATA
TATAAAGGTCACCATCGTTTTATTTCGTCTTTCATTTCACGCATCATTCATTGTGCATGTTTAAAATTGATCGTAGTAGTAACTGATGGCTTTTCTGTTTTCTCGTTCTTCTCATAAATG
GTAGACCAATCTTGTGAAAACTATTAGAATTCTTTCCATTTCAATACGGAGAATATTGTATTTACGTAATGGCTTTATCATTCTATTGAAATCTCAGGACAAGGAGGAGCCCCCTATTGA
AGGCCGCTTGCCTGATGCTACCAAGG
GTGAGTTTAGTCATTCTCCGATTAGTAATTTTTTTTGTATTAGAAGGAAATTAATATCTTATGTTAACAACATTACTTTATTCTTATCTTATGT
CTCTCTAATTTGATCATAATTTTTTTCTGTTATGCAGGATGTGACCACTTGAGGGATGTTTTCGGGAAACAAATGGGTCTGAGCGATCAGGATATTGTAGCACTCTCTGGTGGCCACACT
CTG
GTTTGTATTTGCTACTATTTTACAATTTTCTCCACACTATTAATAATTCTTACATAATATTCTGAGAGGGCTGTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGGAAGATGCC
ACAAGGAACGTTCGGGATTTGATGGACCATGGACTCCTAATCCTCTCATTTTCGATAATTCTTACTTTAC
GTAAGACATATACACCCTCTTATACAGTTATACTTGTGGATTTTGAGTTG
TTATATACGAAATTAATGTATGTTATGTTCTTGCAATTTCTGCTGCTCGAGTCTTGTAATTTGTTTCTCTCTGGATTTGTTAACAGGGTGCTTTTAGGTGGAGATAAAGAAGGTCTTTTG
ATGTTGCCATCAGACAAGGCACTTCTCTCCGATCCTGTCTTCCGCCCCCTTGTTGAGAAATACGCTGCG
GTGTGTGAGCCNNNNNNNNNNNNNNNNNNNNNTAAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNATGTATGTTTGCTTATGGATTGTTTTGATTTAGGATGAGGATGCTTTCTTTGCCGATTATGCTGTGGCTCACATGAAGCTATCCGAGTTGGGGTAATT
AATAAAACGACCTTAGTTATTGTCCAAAGCTTTTCGGTGTTGGCATTTTCGTTAACATTGTACATTTGATTTGCAGATTTGCAGAAGCC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAGAATTACCCAGCTGTGAGTGAAGAGTACCTGAAGGCTGTAGATAAATGTAAGAAGAAGCTCAGAGGGTTTATCGCTGAGAAGAACTGCGCTCCTCTCATGCTCCGCCTTGCG
TGGCACTCTGCTGGTACATTTGACCAAGGCAGCAAAACCGGAGGTCCATTTGGGACAATGAGATTCAAAGCTGAGCAGGGACACGGTGCTAACAATGGTATCCACATTGCTATTAATCTT
TTGGAGCCCATCAAGGAACAGTTCCCCATACTTTCTTATGCCGATTTCTATCAG
TTGGCTGGTGTTGTTGCTGTTGAAATAACTGGAGGGCCTGAAGTTCCATTTCACCCTGGGAGGCAG
GACAAGGAGGAGCCCCCTATTGAAGGCCGCTTGCCTGATGCTACCAAGGGATGTGACCACTTGAGGGATGTTTTCGGGAAACAAATGGGTCTGAGCGATCAGGATATTGTAGCACTCTCT
GGTGGCCACACTCTG
GGAAGATGCCACAAGGAACGTTCGGGATTTGATGGACCATGGACTCCTAATCCTCTCATTTTCGATAATTCTTACTTTACGGTGCTTTTAGGTGGAGATAAAGAA
GGTCTTTTGATGTTGCCATCAGACAAGGCACTTCTCTCCGATCCTGTCTTCCGCCCCCTTGTTGAGAAATACGCTGCG
GATGAGGATGCTTTCTTTGCCGATTATGCTGTGGCTCACATG
AAGCTATCCGAGTTGGG
ATTTGCAGAAGCC

Retrieve as FASTA