Entry information : MguAPx03(mgv1a006830m)
Entry ID 9165
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2016-01-17 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2019-12-10 (Christophe Dunand)
Peroxidase information: MguAPx03(mgv1a006830m)
Name MguAPx03(mgv1a006830m)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguAPx03
start..stop
S start..stop
StAPx06 598 0 18..380 2..373
NtAPx01-1A 594 0 51..381 57..386
NtAPx01-1B 594 0 51..380 57..385
LeAPx08 590 0 23..380 7..371
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1354621..1354812 192 N° 2 1354374..1354523 150 N° 3 1353810..1353930 121 N° 4 1353629..1353729 101
N° 5 1353456..1353543 88 N° 6 1352686..1352753 68 N° 7 1352515..1352601 87 N° 8 1351888..1351962 75
N° 9 1351723..1351800 78 N° 10 1351536..1351640 105 N° 11 1351014..1351088 75 N° 12 1350912..1350917 6
complement(join(1350912..1350917,1351014..1351088,1351536..1351640,1351723..1351 800,1351888..1351962,1352515..1352601,1352686..1352753,1353456..1353543,1353629. .1353729,1353810..1353930,1354374..1354523,1354621..1354812))


exon

Literature and cross-references MguAPx03(mgv1a006830m)
DNA ref. Phytozome 11:   scaffold_64 (1354812..1350915)
Protein sequence: MguAPx03(mgv1a006830m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   382
PWM (Da):   %s   41441.13  
PI (pH):   %s   7.59
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTDRLSTTAAAMVSISAAATNSAATRLIPSVAVSAFTTRLSSRTTLSLTSLRSSPLISRLFLPQETSVRRFSSGRIGYSTASSPKCAASDPEQLKGAREDIKELLKSTFCHPILVRLGWHDAGTYNKNIEEWPQRGGANGSLRFEIELKHGANAGLVNALKLLQPIKEKYSSVTYADLFQLASATAIEAGGPKIPMKYGRVDVSEPEQCPEEGRLPDAGPPSPASHLRDVFNRMGLDDEIVALSGAHTLGRSRPDRSGWGKPETKYTKDGPGAPGGQSWTVQWLKFDNSYFKDIKEKKDEDLLVLPTDAVLFDDPAFKEYAEKYAVDVDAFFKDYAEAHAKLSSIGAKFDPPEGFSLDDIPAKGQPEKFVAAKYSTGKD*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTGATCGTCTGTCAACCACTGCAGCAGCCATGGTTTCCATTTCCGCCGCCGCCACCAACTCAGCCGCCACACGCCTCATCCCTTCCGTCGCCGTCTCCGCCTTCACCACCAGACTC
TCCTCCCGCACCACACTCTCCCTCACCTCCCTCCGCTCGTCCCCTCTCATCTCCCGCCTCTTCCTTCCCCAG
GTAGACCGACTTATATATACATACATACATACATCCATTTTCAGGATT
CGCTCGTGTAATTAGCTTATTGTGTATTGCTGTATAAATCATAAAACAGGAAACCTCCGTGCGGCGATTTTCGAGTGGGAGAATTGGTTATTCGACGGCGTCGTCGCCTAAATGTGCGGC
ATCGGACCCCGAGCAGCTGAAGGGTGCGCGCGAGGATATAAAAGAGCTTCTTAAGTCTACGTTCTGTCACCCTATTCTG
GTTAATTTCTTTGCTATTTCCTTATTTTATAAATGTAATTG
GGAAATATGTTCTGATTTTTGAAGAATTACATTGGTTAATTGTTGGATATGCTTGTGGTTTTGGATGTGTGTTTGTATCTATTAACTGCTGGAGATTTTTCGATTCTGTTTATCGATGTT
CGTTTAGGAGAGCCTACATAGTGATTGAATGGCTTTTTCGCTGCTTCGGAAACTCGAGCTTCATCTCGTTTTAGGCTATAAAATATATTTTTGTAATTGTTGTTCAAAATCGAGGTAATT
CGGAAGGTAGAATTTGAGTCCTCCGTGTGGATCGATGATGAGATATGTTTAAGAGAAGCTTGTATTAATTGGTGGTAGTTGTTCGTATTATGTTATTGTTTATTACCACTAGTATCATTG
TGGTTGTTGATTTTGTTGCCATAATTTATAATTATAATATAGGTCCGTCTGGGTTGGCACGATGCTGGTACGTATAACAAGAACATTGAGGAGTGGCCACAAAGGGGTGGGGCCAATGGA
AGTTTAAGATTTGAAATAGAACTGAAACATGGAGCAAATGCTG
GTAAGCTTTTCATTTTATAATACGATTGCTTATCAGTTAATGATTATGTTATTGTCACTTGACACGCCGGGCCTGCA
CAGGGCTTGTGAATGCTCTTAAACTTCTTCAGCCCATCAAGGAGAAGTACTCTAGTGTCACCTATGCAGACTTGTTTCAATTGGCTAGTGCTACTGCTATAGAGGTTGTTCGTCTCTTCT
GGATTCTATGTGAATGAGAACACTTTATTTTAATCGGTGATTGCGCTAATACCATTGTTCTAATTACAGGAAGCCGGGGGTCCCAAAATTCCTATGAAGTATGGAAGAGTAGATGTATCT
GAACCTGAACAATGTCCAGAAGAAGGAAGGCTCCCAG
GTAAAAATAACTCTAACACTTGACAACGTGTTTGTTGTGCATGGCACGACACTTACCTAATATTAAAACATTACCGATCACGT
TTAAATGCTTATATCAATTTGCCGTTTGTTGCACTTGAATGGACTGGAAGAGCATGGTGGGGTATTACTTATTGGGGTCCAATCTTGTGAGGACTCTTCAAGATTGTGATTGTAATGGCA
GAAACTCTTTAATGCGTTTTGTCTAAGAAATTTAAGTGATTCTGTGTTGATGAGGTTCCGAACTATAGTTTTGGAGCTATTATCTGTCGTAGAATGTATTGACATTGTTATGTGGATGTT
TCAAGTAAAAAGGAAAAAATATTAACGAACAAGTTATTTCAACATGTGATGCAGCTCCAAATATAAGATGACATGTCATTCTTTGTGGAGTATTGTTATTTTTCCTATAAAATTGGAACC
CGAAAATTATCGAAAGTATCAGTTAATCAAGTTTCATTTTAAAAAGATGCGCAACTTAACTCTCTATTCTGTTTCTCTATTGCCCTTTTTTTTAAAAACAATAATGTTTTGATGATAAGT
TTGTTTTACTGTTATACAGCTTTGTATAAAATATGCAAATTATTTTTGCATGCCATATTGGAAGTTGGAACCTAATAATTGACTTTTATGTACTGGCATTCACCTTTAAACCTTAGCTAA
TATTATTTTCACTTATTAGATGCTGGCCCTCCTTCTCCCGCTTCTCATTTACGTGATGTCTTCAATCGGATGGGACTGGATGATAAGGTGATCGGTCGTTCTAATATAACCCGATATCTA
TTGTCAATAATAGTGTTGCAACTTACAATTGCTGAGCTTCTTGATGTTCAGGAAATAGTTGCTCTTTCCGGTGCACATACTCTCGGAAGGTCAAGGCCGGATCGTAGTGGATGGGGCAAA
CCTGAAACCAAATACACG
GTACCAAGACAGGCCATTGTTTTATCATTTATTTGCCGATCATCACATTCTACTTTCTATATACGTGCTGTTTTAACCAGTTAAGAGATCGATAGGATAGAC
TTGTCATGCCTTAGGAAGTACCACAAGTATGCACCAAAATAAAGAAGTAGTTTCTCCTTTTCAATTTTCTTTTTTGGTTGGGAGGGGGGCGGGGGTGAGGTACTGCAAAAGAAACTTGTG
GGATTACATATGCAGCAGTTCGGACCATAGGAAAATAACATTGTGGTCATGCTAACGAGGCATCAAGAATTTAAATGATATCTTGTTACTGAAACTTAATCTTATGCTGCATGCAGAATT
AGACAAGTTGATGTTTATGCTTATTATTATGGTTAAAGAAGTAGTCATAACACGCAGCAATAAGTTTCTGGCCAGGCGAAATGTCATGGAATGAATTTTTTTATTGTTTGCCAAGTTAAC
AGTTGCTAAAATAAAAAAAACAACAGTAACAATAGCTTATCTTTCTACATAAGTGTAAACGTACTAAGCTGGAGTTTCTTTGCATTGCAGAAAGATGGACCTGGGGCTCCTGGAGGCCAA
TCGTGGACAGTGCAGTGGCTGAAATTTGATAATTCCTACTTTAAG
GTGATTTATGTTGGATATTCAAGTCTTTGTGGCTTTGATTTTAACTAAAGTTGCTCAATTCTGCTTCTATGCACG
ACTAATTTGTAGGATATTAAAGAAAAAAAAGATGAGGATCTGCTAGTTTTACCTACAGATGCTGTTCTGTTTGACGATCCAGCATTTAAGGTCAAATAACAAAAATATCACCTCTAAAAG
CATTACTTTTATGTTATGGATTCTGAGCTTACATACAAGTATGCATGTGTAGGAATACGCAGAGAAATATGCTGTGGATGTAGATGCATTTTTCAAAGATTATGCTGAAGCTCATGCTAA
GCTTAGCAGTATTGGAGCTAAATTTGATCCACCTGAG
GTATTTATCCTTGTCCTTTTTATTTTTTACCACCCCGTATCGATCTACTTTGAGCTTTATAAAACTCATATTCAGCCTATCTG
CTGAACTGAACTTGAATCCGATACTCCAGAACGTGGTCAAATTTGCCATCTAGTTTACTTGCAATTCATCTGGAGTCTGTTTATTATATATATATAGTCCTTCCCGATAGAATATACAAA
AAATAAAAATAAAAAAATGCATCACCCTCCTACTGTTGTTTGCTCATAATATTTGGTTCCCATCTTTATTGACTTCATTGAAACTGCTTTATGTCGTGTTTATCTGACAAACTATTAATA
ATTTGTTTTTGCTGCTCTCAACCCATTCTTGTTTCATTTTTTTTGATTCTCACTTCGAGTTTATTATTATAATATAATTACAAAGTGACCAGATGAATAACTCAACTCGTAATTTATGTT
GCAGGGTTTCTCGTTAGATGACATTCCCGCAAAAGGTCAGCCAGAGAAATTTGTGGCAGCCAAGTACTCAACGGGAAAGGTAATTGCTTCCCTTTCTTTCGTGACATGAAAAAAGATTTC
ATAAAACTAACAAAAACAGGGTATTTAAAATTCTTACTTGTTATGGCTGATGCAGGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTGATCGTCTGTCAACCACTGCAGCAGCCATGGTTTCCATTTCCGCCGCCGCCACCAACTCAGCCGCCACACGCCTCATCCCTTCCGTCGCCGTCTCCGCCTTCACCACCAGACTC
TCCTCCCGCACCACACTCTCCCTCACCTCCCTCCGCTCGTCCCCTCTCATCTCCCGCCTCTTCCTTCCCCAG
GAAACCTCCGTGCGGCGATTTTCGAGTGGGAGAATTGGTTATTCGACG
GCGTCGTCGCCTAAATGTGCGGCATCGGACCCCGAGCAGCTGAAGGGTGCGCGCGAGGATATAAAAGAGCTTCTTAAGTCTACGTTCTGTCACCCTATTCTG
GTCCGTCTGGGTTGGCAC
GATGCTGGTACGTATAACAAGAACATTGAGGAGTGGCCACAAAGGGGTGGGGCCAATGGAAGTTTAAGATTTGAAATAGAACTGAAACATGGAGCAAATGCTG
GGCTTGTGAATGCTCTT
AAACTTCTTCAGCCCATCAAGGAGAAGTACTCTAGTGTCACCTATGCAGACTTGTTTCAATTGGCTAGTGCTACTGCTATAGAG
GAAGCCGGGGGTCCCAAAATTCCTATGAAGTATGGA
AGAGTAGATGTATCTGAACCTGAACAATGTCCAGAAGAAGGAAGGCTCCCAG
ATGCTGGCCCTCCTTCTCCCGCTTCTCATTTACGTGATGTCTTCAATCGGATGGGACTGGATGATAAG
GAAATAGTTGCTCTTTCCGGTGCACATACTCTCGGAAGGTCAAGGCCGGATCGTAGTGGATGGGGCAAACCTGAAACCAAATACACGAAAGATGGACCTGGGGCTCCTGGAGGCCAATCG
TGGACAGTGCAGTGGCTGAAATTTGATAATTCCTACTTTAAG
GATATTAAAGAAAAAAAAGATGAGGATCTGCTAGTTTTACCTACAGATGCTGTTCTGTTTGACGATCCAGCATTTAAG
GAATACGCAGAGAAATATGCTGTGGATGTAGATGCATTTTTCAAAGATTATGCTGAAGCTCATGCTAAGCTTAGCAGTATTGGAGCTAAATTTGATCCACCTGAGGGTTTCTCGTTAGAT
GACATTCCCGCAAAAGGTCAGCCAGAGAAATTTGTGGCAGCCAAGTACTCAACGGGAAAG
GACTAA

Retrieve as FASTA