Entry information : MguAPx05 ( mgv1a007111m)
Entry ID 9167
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2016-01-17 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-17 (Achraf Jemmat)
Peroxidase information: MguAPx05 ( mgv1a007111m)
Name (synonym) MguAPx05 ( mgv1a007111m)
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguAPx05
start..stop
S start..stop
SaAPx05 543 0 1..344 1..348
VvAPx07 520 0 4..344 3..344
NtAPx09-1A 513 0 5..344 10..346
PpeAPx05 511 0 3..344 2..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 222471..222554 84 N° 2 222640..222741 102 N° 3 223509..223593 85 N° 4 223684..223718 35
N° 5 223806..223871 66 N° 6 223967..224007 41 N° 7 224093..224223 131 N° 8 224314..224558 245
N° 9 225026..225160 135 N° 10 225266..225376 111  
join(222471..222554,222640..222741,223509..223593,223684..223718,223806..223871, 223967..224007,224093..224223,224314..224558,225026..225160,225266..225376)


exon

Literature and cross-references MguAPx05 ( mgv1a007111m)
DNA ref. Phytozome 12:   scaffold_35 (222471..225373)
Protein sequence: MguAPx05 ( mgv1a007111m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344
PWM (Da):   %s   37323.01  
PI (pH):   %s   8.59
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAVSFMSTVPSLVQPTSAPKHFPRHNSSTVNCKIGADSDHENGFSRRHILQSFGIGATIGIDLIARSTSFVEVANAADLIERKQRSEFLSQMKGTFATVLGNQDLVPSVLTLALNDAVTYDKATKSGGPNGSIRFSSEISRPENKNLAAALNLLEETKKEIDSYSKGGPISYADLIHFAQSAVKSTFLASAIRKCGGNEQKGAILYTAYGSSGQWGLFDRQFGRSDAGKPDPEGRVPQWDNSTVVEMKNKFSNLGFGPRLAVMSAFLGPDQSATEALLASDPEVLPWVQKYQRSRETVSQTDYEVDLITALTKLSSLGQQINYEAYTYPVKRVDFSKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCGGTCTCATTCATGTCAACTGTGCCTTCGTTGGTTCAACCTACCTCAGCCCCTAAACATTTTCCTAGACATAATTCTGTGAGTCAATCTCTCTTCTCTCTTCATTTCTCTTTC
AAATGATTTGGTACTTCATTGTTTATTTATTTATGGTAATTAATCACAGAGCACAGTAAATTGCAAAATCGGAGCTGATTCTGATCATGAGAATGGCTTCTCACGGCGCCACATTCTTCA
ATCATTCGGAATTGGAGCCACCATCGGCATT
GTCAGTCTTTTGCTTTCATTTTTTATTTCTAATTTTTTTTATTTTGGATAATTTTGTGATTAATGTTTCTCATTAATATATATATATAT
ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATTTAGACCTCGTTTGGTTGCCAAGATAAGATTAGACATG
ATAAAATTAAATAATCTAATGAAACCAATTATTTTATGGGACTTCCGCGATGTCCAACAACAAAGGCTCCCTAGAAGGCAAGATAATCCATAATAATATAATTTTGGTGGGTCGACCCGA
CAATTTATTAGGGATACCAAATATCAAACAAAGTCTAATTATTTAGTTAATCATGGCTAATCTCCCCAGCCAAGCAAGGCCTCTTAGTATGTGCTCATAAAATCCATTTTAGGGGTTTAA
TTCAACCAAGCAAAAAGATCAGTCGTTTTGTGGGTTTAATTTAATTTTTCGGCCGGAACGAAACAACTTTTGTTAAAATGCTAAAATAAATAGGTGTTTTGGTACACCTCTGCCGGTGTT
CGTTATATTCCTGCTATGCAGACTCGAAAAAGGTCGCAGCATTTGCCATCTCATTTCTTTCAGAATATCATTAGCTCACATACATAAAACGAAATGGAATTCAGAAGTATATAGTTGAAT
ATTTATTGAGAATTGAGATGAACAAATACAAGTGATATATGATGATGAGTTTGTCGGTTGACCGTTGACCGTTCACAGGACTTGATAGCAAGGTCCACCTCATTCGTTGAAGTGGCTAAT
GCTGCTGATTTGATAGAACGGAAGCAACGTTCGGAGTTTCTGT
GTAAGCTTTACGAATACCCTTGTTTCTTTTCTTTCTAAATTTTTGATCCATCTTTTTGTTTATTTTTATTTTTTATT
TTTTTTTTAATAGCGCAAATGAAGGGGACATTCGCTACTGTTCTGAAGGTTTGGTGTCAAGAACTAAGAAATTCATTTGATATACGTCTGCGATTTTTCTTAGTATACATACTAAATGTT
ATAATTTTTATGCAGGGGAATCAAGATCTCGTGCCGTCTGTATTAACTTTGGCACTCAATGATGCCGTAACTTATGATAAGGTCAGATGTGGTATTGCATATTTATATATCGTTAAATAT
ATTTCGAAACGAAACAAAAAATAAAAAACTTATGCAGTTACTAATTAAGTTTGCAGGCAACAAAATCTGGAGGCCCAAATGGATCAATACGGTTTAGGTAACTTGAATTACATTTCGCAT
TTTGAATTCCGTGGGTTTGATTTGATTTTGTTTTTGTCTTGTATTACGTTTGTTTCGTGAAGCTCAGAGATTAGCCGACCAGAAAATAAGAATCTCGCGGCTGCTTTAAATCTGTTGGAG
GAAACGAAGAAGGAAATAGATTCGTACTCCAAAGGAGGACCTATATCGTACGCCGATCTCATCCACTTTGCAG
GTTAATTGCATGCCGAGGAAGCTTGAATAAAAAACCTTAAATCAATG
CAATAAAAAAAAAAGATTAAATTTGATTCGTTTATCAATGCAGCTCAAAGTGCAGTTAAATCTACGTTCCTGGCGTCAGCCATTCGTAAATGTGGTGGGAATGAACAAAAAGGGGCCATA
CTGTACACTGCATATGGTTCGAGTGGGCAGTGGGGACTGTTTGATAGGCAGTTTGGAAGGTCGGATGCCGGAAAACCCGATCCTGAAGGAAGGGTCCCTCAATGGGATAATTCCACTGTC
GTTGAAATGAAGAACAAATTTTCTAATCTCGGCTTTGGCCCCCGTCAG
GTATAAAAGAATTAAGACTAAAAAAAAAAAAAAAAATTCATCCATCTTCATGGACTTGGTAGCTTATAGAAA
AATCCAATTTGGTTCTTAATTTAGGATTATCCATAATAATCGTATATCAAAATCCTAATACAGTTAAACCTCTATAAATTAACACAGTCGGGACTAGGGAAATTCTATTAATTTAGCGAA
ATATTAAATTAACAAGTGAATAATTTAGCACGTTCTTACCGAGTCGGGACCAGAAAAAAATATTATTTAAGCGAGGTTATTAATTTATCGATGTTCTACTGTATATTGTTTTTCAATAGG
AGGTCCAATAAATAATCTCCCAATTAGCCAAGATTAGTAGAAGCATTCTTTCCGCAATCCTGGGCGCCAAACATTCAATAAATTCCAATTATTTAATTATTAATCATGGCTAATTTTATC
AACCAAACAAGTAATCCAATCTTGATGTTTTGCAGCTAGCTGTGATGTCGGCATTCTTGGGTCCGGACCAATCTGCAACTGAGGCATTACTTGCCTCCGATCCGGAAGTGTTGCCATGGG
TTCAGAAGTACCAACGTAGCCGTGAAACAGTATCGCAAACTGATTATGAG
GTCACTATTAATTACTAATTTATAACTTATATCTATTTTTTTTTTACGAAAAACCTGTTTTTTTATTTGT
TTGTTTTCTGAAAGTGATTGGTTTAACAAATCCAGGTTGACCTGATCACCGCGCTGACAAAATTGAGTTCGTTGGGGCAGCAAATCAATTATGAGGCGTATACGTATCCTGTCAAAAGAG
TTGATTTTAGCAAACTCAAACTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCGGTCTCATTCATGTCAACTGTGCCTTCGTTGGTTCAACCTACCTCAGCCCCTAAACATTTTCCTAGACATAATTCTAGCACAGTAAATTGCAAAATCGGAGCTGATTCTGAT
CATGAGAATGGCTTCTCACGGCGCCACATTCTTCAATCATTCGGAATTGGAGCCACCATCGGCATT
GACTTGATAGCAAGGTCCACCTCATTCGTTGAAGTGGCTAATGCTGCTGATTTG
ATAGAACGGAAGCAACGTTCGGAGTTTCTGT
CGCAAATGAAGGGGACATTCGCTACTGTTCTGAAGGGGAATCAAGATCTCGTGCCGTCTGTATTAACTTTGGCACTCAATGATGCCGTA
ACTTATGATAAG
GCAACAAAATCTGGAGGCCCAAATGGATCAATACGGTTTAGCTCAGAGATTAGCCGACCAGAAAATAAGAATCTCGCGGCTGCTTTAAATCTGTTGGAGGAAACGAAG
AAGGAAATAGATTCGTACTCCAAAGGAGGACCTATATCGTACGCCGATCTCATCCACTTTGCAG
CTCAAAGTGCAGTTAAATCTACGTTCCTGGCGTCAGCCATTCGTAAATGTGGTGGG
AATGAACAAAAAGGGGCCATACTGTACACTGCATATGGTTCGAGTGGGCAGTGGGGACTGTTTGATAGGCAGTTTGGAAGGTCGGATGCCGGAAAACCCGATCCTGAAGGAAGGGTCCCT
CAATGGGATAATTCCACTGTCGTTGAAATGAAGAACAAATTTTCTAATCTCGGCTTTGGCCCCCGTCAG
CTAGCTGTGATGTCGGCATTCTTGGGTCCGGACCAATCTGCAACTGAGGCA
TTACTTGCCTCCGATCCGGAAGTGTTGCCATGGGTTCAGAAGTACCAACGTAGCCGTGAAACAGTATCGCAAACTGATTATGAG
GTTGACCTGATCACCGCGCTGACAAAATTGAGTTCG
TTGGGGCAGCAAATCAATTATGAGGCGTATACGTATCCTGTCAAAAGAGTTGATTTTAGCAAACTCAAACTATAG

Retrieve as FASTA