Entry information : SbPrx132 (Sobic.010G140700.1 [2.1] / Sb10g016100 [1.4])
Entry ID 917
Creation 2008-10-28 (Christophe Dunand)
Last sequence changes 2008-10-28 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx132 (Sobic.010G140700.1 [2.1] / Sb10g016100 [1.4])
Name (synonym) SbPrx132 (Sobic.010G140700.1 [2.1] / Sb10g016100 [1.4])
Class Class III peroxidase    [Orthogroup: Prx133]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Ovaries
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx132
start..stop
S start..stop
ZmPrx23 596 0 23..406 29..421
SiPrx42 556 0 30..406 18..372
OsPrx79 481 1e-170 20..355 21..353
BdiPrx29 474 6e-168 1..406 1..370
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28471159..28471383 225 N° 2 28470042..28471037 996  
complement(join(28470042..28471037,28471159..28471383))


exon

Literature and cross-references SbPrx132 (Sobic.010G140700.1 [2.1] / Sb10g016100 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_10 (28471383..28470042)
Protein sequence: SbPrx132 (Sobic.010G140700.1 [2.1] / Sb10g016100 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   406 (382)
PWM (Da):   %s   45070.78 (42539.5) Transmb domain:   %s   i5-27o
PI (pH):   %s   6.25 (6.32) Peptide Signal:   %s   cut: 25 range:25-406
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQHTLLFLFGLLASATQLCAVDALIVNGLRVGFYGKTCPVAESVISDIVNNEIAMDRGISPGLIRLFFHDCFITGCDASILLDVSPAGDVPEKESSANGFTLVGLRTIDLAKSTLEGMCPGTVSCADILAFAARDAAVAAGLPRYDVVAGRRDGMRSNMDDLPGNFPVPGHHVPRLTELFNQRGLSQEDLVLLSGAHSIGGAHCFMFANRIYNFSKNADIDPTLDPNYAKWLRQRCPPRKPDDDPEQAPKVKFDAQTGEKLDVAYYSELLARRGLLTSDNALIEDPQTKAMVEAFARNEALWQQKFAQAMQKVGMLDVLIGEGKGQVRKQCRLVNEQEKAIEQQQPQQEEQQPPQEEEEQQQQQPQPHLPWFLQRRRPRPQHRPRVPFRRHPVADLVNGFFRGFH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, intron 1) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGCAGCACACGTTGCTGTTCCTTTTTGGCTTGTTGGCGTCGGCGACCCAGCTGTGTGCCGTCGATGCGTTGATCGTCAACGGCCTGCGGGTGGGGTTCTATGGCAAGACGTGCCCG
GTGGCCGAGAGCGTCATCAGCGATATCGTCAACAACGAAATCGCTATGGACCGCGGCATCTCCCCAGGCCTCATTCGCCTCTTCTTCCACGACTGTTTCATCACG
GTAACTTCCCTAATT
AACACTCAACCTTTACTCACACTTATGCTGCATGCATGCACAACATATCGTCGTTGTCTGATGACATGCCTGTGCCGCCGGCCGGCCGGTTCTGTGCATCTATCAGGGTTGCGACGCTTC
TATTCTCCTGGACGTGTCGCCCGCTGGCGATGTCCCAGAGAAGGAGTCGTCTGCCAACGGCTTCACCCTCGTCGGCCTTAGAACCATCGACCTCGCCAAGTCCACTCTAGAGGGCATGTG
CCCCGGCACGGTCTCATGCGCAGATATCCTCGCCTTCGCGGCGCGGGACGCCGCCGTGGCCGCGGGCCTCCCAAGATACGACGTCGTGGCAGGACGCCGAGACGGCATGCGCTCAAACAT
GGACGACCTCCCGGGCAACTTCCCTGTGCCGGGCCATCACGTCCCGCGCCTCACCGAGCTCTTCAACCAGCGAGGCCTCTCCCAGGAGGATCTTGTCTTGCTCTCCGGCGCGCACTCCAT
CGGGGGCGCACATTGCTTTATGTTCGCCAACCGCATCTACAACTTCTCCAAAAACGCCGACATCGACCCAACGCTGGACCCGAACTATGCCAAGTGGCTACGCCAGAGGTGCCCGCCGCG
GAAGCCCGACGACGACCCCGAGCAAGCGCCCAAGGTGAAGTTCGATGCGCAAACAGGAGAGAAGCTCGACGTCGCCTACTACTCCGAGCTGCTCGCCCGGCGCGGCCTGCTCACCTCTGA
CAACGCTCTCATCGAGGACCCACAGACAAAGGCGATGGTTGAGGCCTTCGCCCGGAACGAAGCACTGTGGCAGCAGAAGTTCGCCCAGGCGATGCAGAAGGTCGGAATGCTTGACGTGCT
CATCGGCGAGGGCAAGGGCCAGGTAAGGAAGCAGTGCCGCCTGGTGAACGAGCAGGAGAAGGCTATCGAGCAGCAGCAGCCACAACAGGAGGAGCAGCAGCCCCCACAGGAGGAGGAGGA
GCAGCAGCAGCAGCAGCCACAGCCACACCTTCCGTGGTTCCTGCAGAGGCGCCGGCCCCGGCCGCAGCATCGGCCACGTGTACCGTTTCGCCGTCATCCTGTGGCCGACCTGGTCAACGG
ATTTTTCCGTGGTTTTCACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGCAGCACACGTTGCTGTTCCTTTTTGGCTTGTTGGCGTCGGCGACCCAGCTGTGTGCCGTCGATGCGTTGATCGTCAACGGCCTGCGGGTGGGGTTCTATGGCAAGACGTGCCCG
GTGGCCGAGAGCGTCATCAGCGATATCGTCAACAACGAAATCGCTATGGACCGCGGCATCTCCCCAGGCCTCATTCGCCTCTTCTTCCACGACTGTTTCATCACG
GGTTGCGACGCTTCT
ATTCTCCTGGACGTGTCGCCCGCTGGCGATGTCCCAGAGAAGGAGTCGTCTGCCAACGGCTTCACCCTCGTCGGCCTTAGAACCATCGACCTCGCCAAGTCCACTCTAGAGGGCATGTGC
CCCGGCACGGTCTCATGCGCAGATATCCTCGCCTTCGCGGCGCGGGACGCCGCCGTGGCCGCGGGCCTCCCAAGATACGACGTCGTGGCAGGACGCCGAGACGGCATGCGCTCAAACATG
GACGACCTCCCGGGCAACTTCCCTGTGCCGGGCCATCACGTCCCGCGCCTCACCGAGCTCTTCAACCAGCGAGGCCTCTCCCAGGAGGATCTTGTCTTGCTCTCCGGCGCGCACTCCATC
GGGGGCGCACATTGCTTTATGTTCGCCAACCGCATCTACAACTTCTCCAAAAACGCCGACATCGACCCAACGCTGGACCCGAACTATGCCAAGTGGCTACGCCAGAGGTGCCCGCCGCGG
AAGCCCGACGACGACCCCGAGCAAGCGCCCAAGGTGAAGTTCGATGCGCAAACAGGAGAGAAGCTCGACGTCGCCTACTACTCCGAGCTGCTCGCCCGGCGCGGCCTGCTCACCTCTGAC
AACGCTCTCATCGAGGACCCACAGACAAAGGCGATGGTTGAGGCCTTCGCCCGGAACGAAGCACTGTGGCAGCAGAAGTTCGCCCAGGCGATGCAGAAGGTCGGAATGCTTGACGTGCTC
ATCGGCGAGGGCAAGGGCCAGGTAAGGAAGCAGTGCCGCCTGGTGAACGAGCAGGAGAAGGCTATCGAGCAGCAGCAGCCACAACAGGAGGAGCAGCAGCCCCCACAGGAGGAGGAGGAG
CAGCAGCAGCAGCAGCCACAGCCACACCTTCCGTGGTTCCTGCAGAGGCGCCGGCCCCGGCCGCAGCATCGGCCACGTGTACCGTTTCGCCGTCATCCTGTGGCCGACCTGGTCAACGGA
TTTTTCCGTGGTTTTCACTGA

Retrieve as FASTA