Entry information : MguPrx03 (mgv11b020127m)
Entry ID 9171
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx03 (mgv11b020127m)
Name (synonym) MguPrx03 (mgv11b020127m)
Class Class III peroxidase     [Orthogroup: Prx017]*
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx03
start..stop
S start..stop
MguPrx74 247 1e-83 1..142 140..280
MguPrx90 155 2e-47 1..142 158..299
MguPrx[P]110 129 1e-39 30..142 2..114
NtPrx81-1B 129 2e-38 1..127 87..211
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49469..49556 88 N° 2 49013..49368 356  
complement(join(49013..49368,49469..49556))


exon

Literature and cross-references MguPrx03 (mgv11b020127m)
DNA ref. Phytozome 12:   scaffold_98 (49556..49013)
Protein sequence: MguPrx03 (mgv11b020127m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   148
PWM (Da):   %s   16250.15  
PI (pH):   %s   4.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPEFHNSVDTLRLKFFEKGLTEADLVLLSGETHTIGTTTCFFVRDRLYAFMGANTSDPAISPALLPSLERQCPKDGSPLDRILLLDQVTGDSFDVQSLINIKNGFSVLPSDSILYENNITKSVVDFYSVPESAFAGDFVVEVQFVMN

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (Both 5' end and 3' end are missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGAATTTCACAATTCCGTCGACACGCTCCGATTAAAGTTCTTCGAGAAAGGACTCACCGAAGCCGATCTCGTCTTGCTGAGTGGTAAGTCNNNNNNNNNNNNNNNNNNNNNNNNG
CATATTAGCTTGGTTTATTCGAGTCACTTTTCGATAAAATCTAATATAAAGGGTTTTTTTTCTATCAGGGGAAACACATACGATCGGTACTACAACATGTTTTTTCGTCAGAGACAGATT
GTACGCCTTCATGGGTGCAAATACATCTGACCCCGCAATTAGCCCCGCTCTGCTACCATCACTGGAGCGCCAATGCCCAAAAGACGGAAGTCCACTAGATCGAATACTACTTCTCGATCA
AGTGACCGGAGATAGTTTTGACGTCCAAAGCTTGATTAACATCAAGAACGGTTTCTCCGTCCTGCCCTCAGATTCGATACTATACGAAAACAACATCACCAAATCCGTTGTGGATTTCTA
CAGTGTCCCCGAATCCGCATTTGCAGGGGATTTTGTTGTGGAAGTTCAATTTGTTATGAATGTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGAATTTCACAATTCCGTCGACACGCTCCGATTAAAGTTCTTCGAGAAAGGACTCACCGAAGCCGATCTCGTCTTGCTGAGTGGGGAAACACATACGATCGGTACTACAACATGT
TTTTTCGTCAGAGACAGATTGTACGCCTTCATGGGTGCAAATACATCTGACCCCGCAATTAGCCCCGCTCTGCTACCATCACTGGAGCGCCAATGCCCAAAAGACGGAAGTCCACTAGAT
CGAATACTACTTCTCGATCAAGTGACCGGAGATAGTTTTGACGTCCAAAGCTTGATTAACATCAAGAACGGTTTCTCCGTCCTGCCCTCAGATTCGATACTATACGAAAACAACATCACC
AAATCCGTTGTGGATTTCTACAGTGTCCCCGAATCCGCATTTGCAGGGGATTTTGTTGTGGAAGTTCAATTTGTTATGAATGTT

Retrieve as FASTA