Entry information : MguPrx06 (mgv1a007622m)
Entry ID 9172
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Christophe Dunand)
Peroxidase information: MguPrx06 (mgv1a007622m)
Name (synonym) MguPrx06 (mgv1a007622m)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx06
start..stop
S start..stop
AmPrx01 613 0 5..334 4..331
TvePrx01 607 0 8..333 3..327
SaPrx29 604 0 3..334 2..334
StPrx01 599 0 8..334 3..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2319199..2319438 240 N° 2 2319528..2319716 189 N° 3 2319808..2320380 573  
join(2319199..2319438,2319528..2319716,2319808..2320380)


exon

Literature and cross-references MguPrx06 (mgv1a007622m)
DNA ref. Phytozome 12:   scaffold_4 (2319199..2320380)
Protein sequence: MguPrx06 (mgv1a007622m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (307)
PWM (Da):   %s   37571.18 (34718.7)  
PI (pH):   %s   8.15 (8.02) Peptide Signal:   %s   cut: 28 range:28-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSCSSNISKALFFLGIIYLSSSVSVFAEQNDDPALVMNYYQDSCPQAEEIIKEQVQLLYKRHKNTAFSWLRNIFHDCFVESCDASLLLDSTRRVLSEKETDRSFGMRNFRYIETIKEALERECPGVVSCADILVLSARDGISLVGGPNIPLKTGRRDGRRSRADILEQHLPDHNESMSVVLQRFASIGIDTPGVVALLGAHSVGRTHCVKLVHRLYPEVDPALNPSHVEHMLYKCPDAIPDPKAVQYVRNDRGTPMKLDNNYYRNILDNKGLLIVDHQLATDKRTKPFVKKMAKSQDYFFSEFSKAITVLSENNPLTGTKGEIRKQCNLANKLH

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (extra intron at 5' end has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTGTTCCTCAAATATTTCGAAGGCTCTCTTCTTCCTCGGAATCATCTACTTATCATCATCGGTGTCTGTTTTCGCAGAACAAAATGACGATCCTGCCCTTGTAATGAACTACTAC
CAGGACTCATGCCCACAGGCAGAAGAAATCATCAAAGAGCAAGTCCAGCTTCTCTACAAGCGCCACAAGAACACCGCTTTCTCCTGGCTCAGAAACATCTTCCATGACTGCTTCGTCGAG
GTCATCTTTTTTTCTTTTTCACAAAATGTTTCGAAATTAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTCATGTGATGCATCTCTACTGCTGGATTCGA
CGAGGAGGGTATTATCGGAAAAAGAAACAGACAGAAGCTTCGGAATGAGGAATTTCAGGTACATTGAAACCATTAAAGAAGCTCTAGAGCGAGAGTGCCCCGGTGTTGTTTCTTGCGCCG
ATATTCTCGTCTTGTCTGCTAGAGATGGCATTTCTTTG
GTAAGTTAGTTAGTTAGTTAATAACTTTACTAAAAAAAAAATACCCTTTTTGGTAATATTTTTCATTGTGTGTTTCTGGTAA
TATAATCAGGTAGGAGGGCCAAACATCCCCCTAAAAACAGGGCGAAGGGACGGCAGAAGAAGCAGAGCGGATATTCTCGAACAACATTTACCAGACCACAACGAAAGCATGTCGGTCGTT
CTACAAAGATTCGCCAGCATCGGGATCGATACCCCCGGCGTTGTCGCGCTGCTCGGCGCCCACAGCGTGGGGCGCACGCACTGCGTGAAGCTGGTGCACCGTTTGTACCCAGAGGTTGAC
CCGGCGCTGAACCCTAGCCACGTGGAGCACATGCTGTACAAGTGCCCCGACGCGATACCCGACCCGAAGGCGGTCCAGTACGTGAGGAACGACCGCGGCACCCCCATGAAGCTCGATAAT
AACTACTATAGAAACATATTGGATAATAAGGGCTTGTTGATTGTTGATCACCAGTTAGCCACCGATAAGAGGACTAAGCCGTTTGTGAAGAAAATGGCGAAGAGCCAAGATTACTTCTTC
AGCGAATTCTCGAAGGCGATCACCGTTTTATCGGAGAACAACCCTCTCACCGGCACCAAGGGTGAGATTAGGAAGCAATGCAACCTTGCAAACAAGCTACAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTGTTCCTCAAATATTTCGAAGGCTCTCTTCTTCCTCGGAATCATCTACTTATCATCATCGGTGTCTGTTTTCGCAGAACAAAATGACGATCCTGCCCTTGTAATGAACTACTAC
CAGGACTCATGCCCACAGGCAGAAGAAATCATCAAAGAGCAAGTCCAGCTTCTCTACAAGCGCCACAAGAACACCGCTTTCTCCTGGCTCAGAAACATCTTCCATGACTGCTTCGTCGAG
TCATGTGATGCATCTCTACTGCTGGATTCGACGAGGAGGGTATTATCGGAAAAAGAAACAGACAGAAGCTTCGGAATGAGGAATTTCAGGTACATTGAAACCATTAAAGAAGCTCTAGAG
CGAGAGTGCCCCGGTGTTGTTTCTTGCGCCGATATTCTCGTCTTGTCTGCTAGAGATGGCATTTCTTTG
GTAGGAGGGCCAAACATCCCCCTAAAAACAGGGCGAAGGGACGGCAGAAGA
AGCAGAGCGGATATTCTCGAACAACATTTACCAGACCACAACGAAAGCATGTCGGTCGTTCTACAAAGATTCGCCAGCATCGGGATCGATACCCCCGGCGTTGTCGCGCTGCTCGGCGCC
CACAGCGTGGGGCGCACGCACTGCGTGAAGCTGGTGCACCGTTTGTACCCAGAGGTTGACCCGGCGCTGAACCCTAGCCACGTGGAGCACATGCTGTACAAGTGCCCCGACGCGATACCC
GACCCGAAGGCGGTCCAGTACGTGAGGAACGACCGCGGCACCCCCATGAAGCTCGATAATAACTACTATAGAAACATATTGGATAATAAGGGCTTGTTGATTGTTGATCACCAGTTAGCC
ACCGATAAGAGGACTAAGCCGTTTGTGAAGAAAATGGCGAAGAGCCAAGATTACTTCTTCAGCGAATTCTCGAAGGCGATCACCGTTTTATCGGAGAACAACCCTCTCACCGGCACCAAG
GGTGAGATTAGGAAGCAATGCAACCTTGCAAACAAGCTACAT

Retrieve as FASTA