Entry information : MguPrx10 (mgv1a008931m)
Entry ID 9174
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx10 (mgv1a008931m)
Name (synonym) MguPrx10 (mgv1a008931m)
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx10
start..stop
S start..stop
SaPrx20 487 8e-175 4..329 21..338
InPrx02 464 7e-166 18..336 27..338
CcampPrx46 453 2e-161 12..332 30..347
CcampPrx45 452 6e-161 11..332 30..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 142999..143226 228 N° 2 142692..142883 192 N° 3 142377..142542 166 N° 4 141870..142291 422
complement(join(141870..142291,142377..142542,142692..142883,142999..143226))


exon

Literature and cross-references MguPrx10 (mgv1a008931m)
DNA ref. Phytozome 12:   scaffold_102 (143226..141870)
Protein sequence: MguPrx10 (mgv1a008931m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336
PWM (Da):   %s   36138.58  
PI (pH):   %s   4.22
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MINNISNKTISSNNYPKEECINDDIGATIILSFGFYLNTCPEAEPIIFSWVEKAVSDDPRMAASLLRLHFHDCFVNGCDASVLLDDTPDFVGEKTAAPNANSLRGFEVIDAIKADLEYVCPQTVSCADILAIAARDSVVLTGGPGWEVEMGRKDSLSGSKSAANNNIPGPNSDLPTLLSKFQNFGLTLQDMVALSGAHTMGKARCSTFISRINGTAGIAGNGPDVNLEYLQSLQQLCFSPESNASTTLAELDHMTPATFDNQYYVNLISGEGLLGSDQVLVSGEVEETRGIVEAYADDVDAFFEDFKRAMMKMGSIVQKGDGEIRRNCRAVNQVQ

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTAATAATATCTCAAACAAAACCATTTCTTCGAACAATTATCCTAAAGAAGAATGCATCAATGATGATATTGGTGCAACTATTATATTAAGCTTTGGTTTCTACTTAAACACTTGT
CCTGAGGCTGAACCCATTATCTTTTCTTGGGTAGAAAAAGCCGTCTCTGACGATCCTAGAATGGCTGCTTCTTTGCTTCGCCTCCATTTCCACGATTGCTTTGTCAAT
GCAAGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTGTTTTATTACATGCATATTATAGTTAAATGTGTGTGTTTTTTTTCTTTGTAATTGAATTTGCAGGGATGTGATGCATCGGT
GTTATTGGACGACACGCCGGATTTTGTTGGAGAGAAAACGGCAGCTCCAAATGCGAACTCGCTGAGGGGGTTTGAAGTGATAGATGCAATAAAAGCTGATCTTGAATATGTTTGTCCACA
AACTGTGTCTTGTGCTGATATCCTTGCTATTGCTGCTAGAGATTCTGTTGTTCTG
GTACATATATGTCCATATTTATATACTATTTTATCACAAACTCTATATTGAAATTAAATGGTTAT
AAAAAAATGATTTTTTATTTTTCACCAATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGACAGGTGGTCCTGGATGGGAAGTGGAAATGGGAAGA
AAAGATAGTTTGAGTGGAAGTAAATCAGCAGCAAATAACAATATACCTGGTCCTAATTCTGATTTACCCACATTGTTGTCCAAATTCCAGAATTTTGGCCTAACCCTACAAGATATGGTT
GCACTCTCTG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAATCCCATAATAAATATGTTATATGATCAGGTGCACACACCATGGGAAAAGCTCG
ATGCTCGACGTTTATCAGCCGGATAAATGGGACCGCTGGAATTGCCGGCAATGGCCCTGATGTTAATCTTGAATATTTGCAGTCGCTGCAGCAACTGTGCTTCTCACCGGAATCGAATGC
CAGCACAACACTAGCGGAGCTTGACCATATGACCCCGGCGACATTTGACAATCAGTACTATGTTAACCTTATATCCGGCGAGGGTTTGCTTGGCTCCGATCAGGTGCTGGTCTCCGGAGA
GGTGGAGGAGACGCGTGGAATTGTAGAGGCTTATGCTGATGACGTGGATGCATTTTTTGAGGATTTTAAAAGGGCGATGATGAAAATGGGGAGTATTGTGCAGAAGGGTGATGGAGAAAT
TCGCCGGAATTGTAGGGCTGTGAATCAAGTTCAGCTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTAATAATATCTCAAACAAAACCATTTCTTCGAACAATTATCCTAAAGAAGAATGCATCAATGATGATATTGGTGCAACTATTATATTAAGCTTTGGTTTCTACTTAAACACTTGT
CCTGAGGCTGAACCCATTATCTTTTCTTGGGTAGAAAAAGCCGTCTCTGACGATCCTAGAATGGCTGCTTCTTTGCTTCGCCTCCATTTCCACGATTGCTTTGTCAAT
GGATGTGATGCA
TCGGTGTTATTGGACGACACGCCGGATTTTGTTGGAGAGAAAACGGCAGCTCCAAATGCGAACTCGCTGAGGGGGTTTGAAGTGATAGATGCAATAAAAGCTGATCTTGAATATGTTTGT
CCACAAACTGTGTCTTGTGCTGATATCCTTGCTATTGCTGCTAGAGATTCTGTTGTTCTG
ACAGGTGGTCCTGGATGGGAAGTGGAAATGGGAAGAAAAGATAGTTTGAGTGGAAGTAAA
TCAGCAGCAAATAACAATATACCTGGTCCTAATTCTGATTTACCCACATTGTTGTCCAAATTCCAGAATTTTGGCCTAACCCTACAAGATATGGTTGCACTCTCTG
GTGCACACACCATG
GGAAAAGCTCGATGCTCGACGTTTATCAGCCGGATAAATGGGACCGCTGGAATTGCCGGCAATGGCCCTGATGTTAATCTTGAATATTTGCAGTCGCTGCAGCAACTGTGCTTCTCACCG
GAATCGAATGCCAGCACAACACTAGCGGAGCTTGACCATATGACCCCGGCGACATTTGACAATCAGTACTATGTTAACCTTATATCCGGCGAGGGTTTGCTTGGCTCCGATCAGGTGCTG
GTCTCCGGAGAGGTGGAGGAGACGCGTGGAATTGTAGAGGCTTATGCTGATGACGTGGATGCATTTTTTGAGGATTTTAAAAGGGCGATGATGAAAATGGGGAGTATTGTGCAGAAGGGT
GATGGAGAAATTCGCCGGAATTGTAGGGCTGTGAATCAAGTTCAGCTA

Retrieve as FASTA