Entry information : MguPrx[P]104 ( mgv1a026804m)
Entry ID 9179
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2015-12-26 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Christophe Dunand
Last annotation changes 2016-02-28 (Christophe Dunand)
Peroxidase information: MguPrx[P]104 ( mgv1a026804m)
Name (synonym) MguPrx[P]104 ( mgv1a026804m)
Class Class III peroxidase     [Orthogroup: Prx169]*
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx[P]104
start..stop
S start..stop
MguPrx99 658 0 1..330 1..330
MguPrx78 481 1e-172 6..328 1..323
MguPrx37 286 4e-96 30..328 24..325
CagraPrx54 270 1e-89 31..328 39..341
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43586..43813 228 N° 2 43926..44289 364 N° 3 44386..44786 401  
join(43586..43813,43926..44289,44386..44786)


exon

Literature and cross-references MguPrx[P]104 ( mgv1a026804m)
DNA ref. Phytozome 12:   scaffold_109 (43592..44786)
Protein sequence: MguPrx[P]104 ( mgv1a026804m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (306)
PWM (Da):   %s   36435.61 (33754.1)  
PI (pH):   %s   5.25 (4.94) Peptide Signal:   %s   cut: 24 range:24-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
M*TRTISTVVLIFLISGFNYQVKGDDDYAGLSFGFYNKTCPQLEKIVEDAISSMSKQDPRTPAALLRLLFNDCKVMGCDASILLDVYERSKSEMGSFSNFGIKKRELIGQIKSMVDKVCPNQVSCADILVLAAREAVAVSQGPKIRVPLGRRDSSVAYTNYDADFNLPPADTFIRKSLGFLENLNVGLTIEEQIALLGAHTLGTSHCATIQYRFDAPWIINTDKEFYEKLQKICPKGAASNFNTSLPNDRTPYVFDADIYVESLRGRALLVTDVDLSDDALTAEIAPKFIFNKDLFFKTFSSAFVKLSTADVLTGNDGEIRRQCDKLNGI*

Retrieve as FASTA  
Remarks Pseudogene from genomic (stop in frame). Incorrect prediction from Phytozome (very short 5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATACGAGAACGATTTCGACGGTTGTTTTAATTTTTTTGATAAGTGGTTTCAATTATCAAGTGAAAGGAGACGATGATTATGCGGGGTTGTCGTTTGGATTTTATAACAAAACGTGC
CCACAACTCGAGAAAATCGTCGAAGATGCAATATCTTCGATGTCGAAACAAGACCCTCGAACACCTGCTGCACTGTTGAGGCTCTTGTTTAATGATTGTAAAGTTAAG
GTAATCAAAGAA
TAAACCGTGTTTTTTTGTTTGGCCGATTCGAAGTAAAATATAATATAAGAAGTCGTTGTCATTCTCTAATTTGCTCGATAAATGTTTATTTTTTATAGGGTTGTGATGCTTCAATCCTTC
TGGATGTTTACGAGAGAAGCAAATCGGAGATGGGGTCATTTAGTAATTTCGGAATCAAGAAAAGGGAGTTGATAGGGCAAATAAAATCGATGGTGGATAAAATTTGTCCGAACCAAGTTT
CGTGTGCAGATATTTTAGTGCTGGCAGCTCGAGAAGCTGTGGCGGTTTCTCAAGGGCCGAAAATCCGGGTCCCACTTGGTCGCCGAGATTCATCCGTTGCGTACACTAATTACGATGCAG
ATTTTGACCTCCCTCCGGTCGATACGTTCATCAGAAAATCGTTGGGGTTTTTAGAAAACTTGAATGTGGGATTGACTATCGAAGAACAAATTGCACTCTTAGGT
AATTAATTATTTGTAT
TGCTTGAATTAGAAGTTTAATTAATCGTTTAAAAAAAATGTATCTAATTTCTTTTATTTTTTATTTTTTTTTGGCTTGTAGGTGCTCATACTCTTGGAACTTCTCATTGTGCTACTATAC
AATATCGTTTCGACGCTCCGTGGATTATAAATACGGACAAAGAATTCTATAAGAAATTGCAAAAGATTTGTCCGAAAGGAGCAGCATCTAATTTTAATACATCGTTACCTAACGATCGCA
CACCGTACGTATTCGACGCAGATATATATGTGGAATCATTACGTGGGAGGGGGCTATTAGTGACCGATGTAGATCTATCGGATGATGCTCTCACCGCTGAGATCGCCCCGAAATTTATTT
TCGACAAAGATTATTTTTTCAAGACATTTTCATCTGCTTTTGTTAAACTTTCAACCGCAGACGTTTTAACGGGAAACGATGGCGAAATCCGAAGACAGTGTGATAAGTTGAATGGAGTTT
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATACGAGAACGATTTCGACGGTTGTTTTAATTTTTTTGATAAGTGGTTTCAATTATCAAGTGAAAGGAGACGATGATTATGCGGGGTTGTCGTTTGGATTTTATAACAAAACGTGC
CCACAACTCGAGAAAATCGTCGAAGATGCAATATCTTCGATGTCGAAACAAGACCCTCGAACACCTGCTGCACTGTTGAGGCTCTTGTTTAATGATTGTAAAGTTAAG
TTGTGATGCTTC
AATCCTTCTGGATGTTTACGAGAGAAGCAAATCGGAGATGGGGTCATTTAGTAATTTCGGAATCAAGAAAAGGGAGTTGATAGGGCAAATAAAATCGATGGTGGATAAAATTTGTCCGAA
CCAAGTTTCGTGTGCAGATATTTTAGTGCTGGCAGCTCGAGAAGCTGTGGCGGTTTCTCAAGGGCCGAAAATCCGGGTCCCACTTGGTCGCCGAGATTCATCCGTTGCGTACACTAATTA
CGATGCAGATTTTGACCTCCCTCCGGTCGATACGTTCATCAGAAAATCGTTGGGGTTTTTAGAAAACTTGAATGTGGGATTGACTATCGAAGAACAAATTGCACTCTTAGGT
GGTGCTCA
TACTCTTGGAACTTCTCATTGTGCTACTATACAATATCGTTTCGACGCTCCGTGGATTATAAATACGGACAAAGAATTCTATAAGAAATTGCAAAAGATTTGTCCGAAAGGAGCAGCATC
TAATTTTAATACATCGTTACCTAACGATCGCACACCGTACGTATTCGACGCAGATATATATGTGGAATCATTACGTGGGAGGGGGCTATTAGTGACCGATGTAGATCTATCGGATGATGC
TCTCACCGCTGAGATCGCCCCGAAATTTATTTTCGACAAAGATTATTTTTTCAAGACATTTTCATCTGCTTTTGTTAAACTTTCAACCGCAGACGTTTTAACGGGAAACGATGGCGAAAT
CCGAAGACAGTGTGATAAGTTGAATGGAGTTTA

Retrieve as FASTA