Entry information : SbRboh10 (Sobic.005G139700.1 [2.1] / Sb05g020380 [1,4]RbohD)
Entry ID 918
Creation 2008-11-15 (Christophe Dunand)
Last sequence changes 2008-11-15 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-06 (Messaoudi)
Peroxidase information: SbRboh10 (Sobic.005G139700.1 [2.1] / Sb05g020380 [1,4]RbohD)
Name (synonyms) SbRboh10 (Sobic.005G139700.1 [2.1] / Sb05g020380 [1,4]RbohD)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Inducer Dark growth
Repressor N/D
Best BLASTp hits
Perox score E-value SbRboh10
start..stop
S start..stop
ZmRboh06 1712 0 1..936 1..933
OsiRboh04 1614 0 1..936 1..938
OsRboh08 1613 0 1..936 1..936
TaRboh04 1569 0 25..936 17..917
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49935236..49935875 640 N° 2 49934972..49935128 157 N° 3 49934840..49934888 49 N° 4 49933596..49934746 1151
N° 5 49933228..49933330 103 N° 6 49933038..49933120 83 N° 7 49931242..49931759 518 N° 8 49930109..49930218 110
complement(join(49930109..49930218,49931242..49931759,49933038..49933120,4993322 8..49933330,49933596..49934746,49934840..49934888,49934972..49935128,49935236..4 9935875))


exon

Literature and cross-references SbRboh10 (Sobic.005G139700.1 [2.1] / Sb05g020380 [1,4]RbohD)
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 11:   chromosome_5 (49935875..49930109)
Cluster/Prediction ref. UniGene:   Sbi.18363
Protein sequence: SbRboh10 (Sobic.005G139700.1 [2.1] / Sb05g020380 [1,4]RbohD)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   936
PWM (Da):   %s   104766.67 Transmb domain:   %s   o378-397i522-544o564-586i750-767o
PI (pH):   %s   9.66
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHNPRPGGGDIVEMSSSSSAAAPHEAGARDRERVIPHSGPLSKKTGARKSARFAESVSAPLTAPPPPRASSANNNDDDDDYVEITLDVRDDSVAVHSVKPAHGGGGGGDDSDVTLLARTLENRRASGHSVIRNASSRIKQVSQELRRIASINRRGGGGGARLDRSKSAAAHALKGLKFISKAEGAAGWEAVEKRFDKLAENGLLHRSKFGQCIGMKEPEFAGELFDALSRRRNISGDSISKAELLEFWDQISDTSFDGRLQTFFDMVDKDADGRITEEEVKIITLSASANKLSKITDQAEEYARLIMEELDPANLGYIELYNLEMLLLQAPSQSVRIGTTNSRNLSQMLSQSLRPTPEPNPLRRWYRRVHYFLEDNWRRVWVLLLWLSICAALFAWKFTQYRRRYVFHVMGYCVCVAKGGAETLKFNMALILLPVCRNTITWLRNRTTAVARVVPFDDSLNFHKVVAVGITVGAALHIVSHLTCDFPRLLHATDEAYAPLGQYFGTRRPPDYWWFVKGTEGWTGLVMLVLMAVAFTLATPWFRRGRVALPGPVLRRLTGFNAFWYSHHCFVAVYALLVVHGQYLYLTHKWYKKSTWMYLAVPVALYACERLTRALRSSVRPVKILKVAVYPGNVLSLHFSKPQGFRYRSGQYIFVNCAAVSPFQWHPFSITSAPQDDYVSVHIRTLGDWTRELKNVFSVCRPPTEGKSGLLRAEYDRDGSAMANPSFPKVLIDGPYGAPAQDYKQYDIVLLVGLGIGATPMISIIKDIINNMKQPDGDLEAGAGADTSASSMASSFRTRRAYFYWVTREQGSFEWFRGVMDEVAETDKKGVIELHNYCTSVYEEGDARSALIAMLQSLNHAKHGVDVVSGTRVKTHFARPNWRNVYKRIALNHQNQRGVFYCGAPVLTKELRELAQDFSRKTNTKFEFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 7 introns) and 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATAACCCGAGGCCGGGCGGCGGTGACATCGTCGAGATGTCGTCGTCGTCGTCCGCCGCCGCGCCGCACGAGGCGGGAGCCAGGGACAGGGAGCGCGTGATCCCACACAGCGGCCCG
CTGAGCAAGAAGACCGGGGCGAGGAAGAGCGCGCGGTTCGCCGAGTCCGTGTCCGCGCCTCTCACCGCGCCGCCGCCGCCGCGCGCGTCGTCCGCCAACAACAACGACGACGACGACGAC
TACGTGGAGATCACCCTCGACGTGCGCGACGACTCGGTGGCGGTGCACAGCGTCAAGCCCGCCCACGGCGGCGGCGGCGGCGGAGACGACTCGGACGTGACGCTGCTGGCGCGCACGCTG
GAGAACCGGCGGGCGTCCGGCCACTCGGTGATCCGGAACGCCTCGTCGCGGATCAAGCAGGTGTCGCAGGAGCTCCGCCGCATCGCCTCCATCAACCGCCGCGGCGGCGGCGGCGGGGCG
AGGCTGGACCGGTCCAAGTCCGCGGCCGCGCACGCGCTCAAGGGGCTCAAGTTCATCAGCAAGGCCGAGGGCGCCGCCGGATGGGAGGCCGTCGAGAAGCGCTTCGACAAGCTCGCCGAG
AACGGGCTCCTCCACCGCTCCAAGTTCGGCCAGTGCATCG
GTACTGAGAAATGAATCCTTCTGCTTCGTTGCTTCTTCTTTCGTGCGTTTTGGCGTGTTAATTCGTCGTGTTGTACTAAC
CACACACATGGATCAACAACGCAACAGGGATGAAGGAGCCGGAGTTCGCCGGCGAGCTGTTCGACGCGCTGTCTCGGCGCCGCAACATCTCCGGCGACAGCATCAGCAAGGCCGAGCTGC
TCGAGTTCTGGGACCAAATCTCCGACACCAGCTTCGACGGCCGCCTGCAGACCTTCTTCGACAT
GTACGTTCAGTTGCTTGTAATTACTACAACACACTAGTAATTACGGACCGTCAAAC
GCTCATCTCCCTTAATTACACTTGCAGGGTCGACAAGGACGCGGACGGCAGGATCACCGAGGAGGAGGTCAAAGAGGTAACTTGGTCAACAGCCTTTCCAAGTGTCTTGTTGAACCAAAC
CAAACCAAACCAAACCAAATCAAACGAAACCAACAAATGGTTGCTGCAGATCATCACGCTGAGCGCGTCAGCGAACAAGCTGTCGAAGATCACAGATCAAGCGGAGGAGTACGCTCGTCT
AATCATGGAGGAGCTAGACCCTGCCAACCTGGGCTACATCGAGCTCTACAACCTGGAGATGCTGCTCCTCCAAGCTCCGTCCCAATCCGTGCGGATCGGCACCACCAACAGCCGGAACCT
GAGCCAGATGCTGTCGCAGAGCCTCCGCCCGACGCCGGAGCCGAACCCGCTCCGGCGCTGGTACCGCCGCGTGCACTACTTCCTGGAGGACAACTGGCGGCGCGTGTGGGTGCTCCTCCT
GTGGCTCTCCATCTGCGCCGCGCTCTTCGCCTGGAAGTTCACCCAGTACCGCCGCCGCTACGTCTTCCACGTGATGGGCTACTGCGTCTGCGTCGCGAAGGGCGGCGCCGAGACGCTCAA
GTTCAACATGGCGCTCATCCTCCTGCCCGTCTGCCGGAACACCATCACCTGGCTCCGCAACCGGACCACCGCCGTGGCGCGCGTCGTCCCCTTCGACGACAGCCTCAACTTCCACAAGGT
GGTCGCCGTCGGGATCACCGTGGGCGCCGCGCTCCACATCGTCTCCCACCTGACGTGCGACTTCCCGCGGCTCCTCCACGCCACCGACGAGGCGTACGCGCCGCTGGGGCAGTACTTCGG
GACGCGGCGGCCGCCGGACTACTGGTGGTTCGTGAAGGGCACGGAGGGGTGGACGGGGCTGGTGATGCTGGTGCTCATGGCGGTGGCGTTCACGCTGGCGACGCCGTGGTTCAGGAGAGG
GAGGGTGGCGCTGCCGGGCCCCGTGCTCAGGCGGCTCACCGGGTTCAACGCGTTCTGGTACTCGCACCACTGCTTCGTGGCGGTGTACGCGCTGCTCGTCGTGCACGGGCAGTACCTGTA
CCTGACGCACAAGTGGTACAAGAAGTCGACGTGGATGTACCTGGCCGTGCCCGTGGCGCTGTACGCGTGCGAGAGGCTGACGAGGGCGCTCAGGTCCAGTGTCCGCCCCGTGAAGATACT
CAAGGTGGCGGTTTACCCTGGGAACGTCCTGTCGCTGCATTTCTCCAAGCCGCAGGGGTTTCGGTACAGGAGTGGACAGTACATCTTCGTCAACTGCGCCGCCGTCTCGCCGTTCCAGTG
GTAAGTAGTAAAGCTTTGGGTTTCTTGGAGTTTTTAAGTTTGGAAGGAGTCAGAAGTGGTAGTTTTGAAGGTTTTTTTTGTTGTTGTTGAGATTCATGGTTTGATTATTAGGCTGCTGAT
GCTAGCTTTGTTTAATTAGTTTTTATGTATGCTAGTAGTCCGTCGTTAGTTTAGTTGATGGAAGAAGGGAAGCAAAGCACAGATGCTTCTTCGTCTGTCGGTTAATGACTTTTTTTTTTT
GCGTGTGTCGTTGGTTGCGTTGCAGGCACCCGTTCTCCATCACGTCGGCACCACAGGACGACTACGTGAGCGTGCACATCAGGACGCTGGGTGACTGGACACGCGAGCTCAAGAACGTCT
TCTCGAGG
GTACGTGTATATATATATATATATATATATATATATATATATATATATACGTGTGGTGGATTGCTGCTGCTCTGAAGCTAAACTTGTTGAGTGCTTGCGTGCTGCAGGTGTG
CCGGCCGCCGACGGAGGGCAAGAGCGGGCTGCTCCGCGCCGAGTACGACCGCGACGGCAGCGCCATGGCCAACCCCAG
GTTTGTGACAAAACCACCAATATTATCCAGTTTCCTCGCGTC
TCCACGACAAAAACGTTGAGTGGGAGGGAGCAGAAGATGTTGACGAGTCGTCTCGTGTGGAGCCGGGGGTGTTGGGGTTGGACCGGACCAGGTCTCGCACTCTCGCTGGGTGTGGTGGTA
GGTGGGCAGTGGCCGCGTCGTCGTCACTGGCCGTTCGTCCGTGTGCCACTGTGCTGCTCGCAGATGGAGCTGGTGCTCTCCAGCTGTAGGACGGGTTCACACATGTCAACAAGGTCCAGG
ACCCGCATGGGCTGGGTTGGTTGGTTCGCATTGGCTGGCTCCAGTCCAGTCGGTGGCGCCACCTTCTCTGACCTCTTTATCCCCTTCCCTTCCGTTCCGAGAACCTTTTACCCGGTCAGC
AGGACGTACAAAAAGGCCATGGCATTTGGCATGGCATGGCATGAGATCATCCCTTGCATCACCGGTCTCGACCGTATGGTTTTCTACGGTGCCACACAGCAGCAACACAACACACATAAT
AGCCTTGTATACGTTTCACATTGCCAAAGTGCCAACATAAGCTTCTTTCGGTGTGGACATTTGGGGGTTATTAGCAGGTGTGTTGACCTTGACCCCCTGCGCGCGGGCAGGATCTCCGTC
ACCGAACAGTAGTGGTAGACTGATGGTAGCGGTAGGTGGTGGCTACCTGCCTTGGTTCAGTTCGGCCGGTGGGCATGATGAGCTAGCCGGTGGCCGGCCGGTGATATTCCCGGCGGTGGA
AGATGAGTTCTGTTGGTCCTGCTGGTTTGTCCATGGGCCATATGACCATGTCTGAGGGGGAAAGACGGCCAGTGGTTGGGGATAAGGTGAACAATTGGTCTAGCAACGCCTGCCCATTTA
ATTTGCATGCCCAACATATTCCACTCCGAATATTCTTTCTTTTTTTTCATTGATATAAAAAAAAAATTCTTTGGGACAAAGGACATTCTCTGCACGCGTCGTCCCATTTTCTGCCTGTGA
AACACGGAGAGCGAGCAGCAATGCTGTGTGGCTTGTGAGTGTGGGTTACGTACGGTTCTCCTATTTGATAATCAAACACGGTTGACTTCGCCGCCTCTCCGACAAAACTGATTTTTGACT
CTCTAATATAGTACTGTATACTCCAACTGCTCCTTGGATGAATTTTGAGTTTTTTTTTAACTACAATGTATGCCAACTGCTCCTTGCATTGGATCTTTTGTGCATTTGGTTGACCGTTTG
GATTAATCAAAACTATCATCATTCCTCTGAATGCAGCTTCCCCAAGGTGCTGATCGACGGCCCCTACGGCGCGCCGGCGCAGGACTACAAGCAGTACGACATCGTGCTTCTCGTCGGGCT
GGGCATCGGCGCCACGCCCATGATCTCCATCATCAAGGACATCATCAACAACATGAAGCAGCCGGACGGCGACCTGGAAGCCGGCGCCGGCGCCGACACGTCGGCGTCCTCCATGGCGTC
GTCGTTCCGCACGCGGCGCGCCTACTTCTACTGGGTGACCCGGGAGCAGGGCTCCTTCGAGTGGTTCCGCGGCGTCATGGACGAGGTGGCCGAGACGGACAAGAAGGGCGTCATCGAGCT
CCACAACTACTGCACCAGCGTGTACGAGGAAGGCGACGCCCGGTCGGCGCTCATCGCCATGCTCCAGTCGCTCAACCACGCCAAGCACGGCGTCGACGTCGTGTCCGGGACACGCGTCAA
GACGCACTTCGCCAGGCCCAACTGGCGCAACGTCTACAAGCGCATCGCCCTCAACCACCAGAACCAGCGCGTCG
GTAAGTTTTTTGTTAGTTGCATTCAGACGCCATTTTCCTACGTACT
CTACTACTTTTTTTTTAACCCTGTTTATTTCATCCATCAACACATGCATTTAGCTACTTAATTATTACTACTGCCGACGTCGAATGTGTAGAAAGGTTAATCCAATGTGTGCACATGGTG
GTCTATGCCGCCACGCTTCTCTCTCACTGGATCGATGGATCGCGGTGAAAGAAGCACTCTACCAAACTTGATGCATGGTAGAGTGGATAGGTGTGATGATCGTGGAGTAGTGCAATTGTG
GCTGGCTGGCCTAACTTTGGCCGCAGGACCTAGCGAGCTGACAGGGACAGTCATTATGCATGACCACCAGCACCGGGGCTTTGTGGTGTGCTTGCTATGCGTGTTCAATTTGAACTTTAG
CCATGGTTGAGACTTTGAGAGTGAAATAGGACCGATCACTGTTGCTTGCTGATAGGCACAACCAATAAGTCGGCGATGAGATGATTGATGATTATATAAACAAGAGTTCGCATTGCATTG
GCAACTGCGATTAGATGATTATTTATTGGATTTGTTAAAAGCCGAGTAAGTCTCCTTTTTAAAAAAAATGTGATTAGATTATAGATTAGGGGCTAATTAACCAATCATTGTTACATGCTG
ACAATTATTGGAAGCAAAAATAAAAGTATTAAATGGTGAGCATATAGTCACTTGGAAAGAGATGAATTATGAAGCATGGGCATCTCTATAAAGTTCAATACTAAAAAGTTGGGTCAGATA
TATAGGCACCAGATTTCTTTGACATATAGTATTTCTAAGAGGTGCTGCATGCTCATCACTTGCCTAACTGAGTCAAATCAAGCATGCTTATTAGCAGCTCCACCGTTACCTGAAAAAGGG
GTAAAAGGATAATTAAAACAACAACACGGCCAATCATCATCTTAGTTAATTACTTCATCATACAGTAATGCATTACTTCCTCATACTTCAATTTCTGAATCAGCACTGACATCTTTGATC
GATCTTTGATGTTGCAGGAGTGTTCTATTGTGGTGCTCCGGTGCTGACAAAGGAGCTGCGCGAGCTCGCGCAGGATTTCTCGCGGAAAACCAACACCAAGTTCGAGTTCCACAAGGAGAA
CTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATAACCCGAGGCCGGGCGGCGGTGACATCGTCGAGATGTCGTCGTCGTCGTCCGCCGCCGCGCCGCACGAGGCGGGAGCCAGGGACAGGGAGCGCGTGATCCCACACAGCGGCCCG
CTGAGCAAGAAGACCGGGGCGAGGAAGAGCGCGCGGTTCGCCGAGTCCGTGTCCGCGCCTCTCACCGCGCCGCCGCCGCCGCGCGCGTCGTCCGCCAACAACAACGACGACGACGACGAC
TACGTGGAGATCACCCTCGACGTGCGCGACGACTCGGTGGCGGTGCACAGCGTCAAGCCCGCCCACGGCGGCGGCGGCGGCGGAGACGACTCGGACGTGACGCTGCTGGCGCGCACGCTG
GAGAACCGGCGGGCGTCCGGCCACTCGGTGATCCGGAACGCCTCGTCGCGGATCAAGCAGGTGTCGCAGGAGCTCCGCCGCATCGCCTCCATCAACCGCCGCGGCGGCGGCGGCGGGGCG
AGGCTGGACCGGTCCAAGTCCGCGGCCGCGCACGCGCTCAAGGGGCTCAAGTTCATCAGCAAGGCCGAGGGCGCCGCCGGATGGGAGGCCGTCGAGAAGCGCTTCGACAAGCTCGCCGAG
AACGGGCTCCTCCACCGCTCCAAGTTCGGCCAGTGCATCG
GGATGAAGGAGCCGGAGTTCGCCGGCGAGCTGTTCGACGCGCTGTCTCGGCGCCGCAACATCTCCGGCGACAGCATCAGC
AAGGCCGAGCTGCTCGAGTTCTGGGACCAAATCTCCGACACCAGCTTCGACGGCCGCCTGCAGACCTTCTTCGACAT
GGTCGACAAGGACGCGGACGGCAGGATCACCGAGGAGGAGGTC
AAAGAG
ATCATCACGCTGAGCGCGTCAGCGAACAAGCTGTCGAAGATCACAGATCAAGCGGAGGAGTACGCTCGTCTAATCATGGAGGAGCTAGACCCTGCCAACCTGGGCTACATCGAG
CTCTACAACCTGGAGATGCTGCTCCTCCAAGCTCCGTCCCAATCCGTGCGGATCGGCACCACCAACAGCCGGAACCTGAGCCAGATGCTGTCGCAGAGCCTCCGCCCGACGCCGGAGCCG
AACCCGCTCCGGCGCTGGTACCGCCGCGTGCACTACTTCCTGGAGGACAACTGGCGGCGCGTGTGGGTGCTCCTCCTGTGGCTCTCCATCTGCGCCGCGCTCTTCGCCTGGAAGTTCACC
CAGTACCGCCGCCGCTACGTCTTCCACGTGATGGGCTACTGCGTCTGCGTCGCGAAGGGCGGCGCCGAGACGCTCAAGTTCAACATGGCGCTCATCCTCCTGCCCGTCTGCCGGAACACC
ATCACCTGGCTCCGCAACCGGACCACCGCCGTGGCGCGCGTCGTCCCCTTCGACGACAGCCTCAACTTCCACAAGGTGGTCGCCGTCGGGATCACCGTGGGCGCCGCGCTCCACATCGTC
TCCCACCTGACGTGCGACTTCCCGCGGCTCCTCCACGCCACCGACGAGGCGTACGCGCCGCTGGGGCAGTACTTCGGGACGCGGCGGCCGCCGGACTACTGGTGGTTCGTGAAGGGCACG
GAGGGGTGGACGGGGCTGGTGATGCTGGTGCTCATGGCGGTGGCGTTCACGCTGGCGACGCCGTGGTTCAGGAGAGGGAGGGTGGCGCTGCCGGGCCCCGTGCTCAGGCGGCTCACCGGG
TTCAACGCGTTCTGGTACTCGCACCACTGCTTCGTGGCGGTGTACGCGCTGCTCGTCGTGCACGGGCAGTACCTGTACCTGACGCACAAGTGGTACAAGAAGTCGACGTGGATGTACCTG
GCCGTGCCCGTGGCGCTGTACGCGTGCGAGAGGCTGACGAGGGCGCTCAGGTCCAGTGTCCGCCCCGTGAAGATACTCAAGGTGGCGGTTTACCCTGGGAACGTCCTGTCGCTGCATTTC
TCCAAGCCGCAGGGGTTTCGGTACAGGAGTGGACAGTACATCTTCGTCAACTGCGCCGCCGTCTCGCCGTTCCAGTG
GCACCCGTTCTCCATCACGTCGGCACCACAGGACGACTACGTG
AGCGTGCACATCAGGACGCTGGGTGACTGGACACGCGAGCTCAAGAACGTCTTCTCGAGG
GTGTGCCGGCCGCCGACGGAGGGCAAGAGCGGGCTGCTCCGCGCCGAGTACGACCGCGAC
GGCAGCGCCATGGCCAACCCCAG
CTTCCCCAAGGTGCTGATCGACGGCCCCTACGGCGCGCCGGCGCAGGACTACAAGCAGTACGACATCGTGCTTCTCGTCGGGCTGGGCATCGGCGCC
ACGCCCATGATCTCCATCATCAAGGACATCATCAACAACATGAAGCAGCCGGACGGCGACCTGGAAGCCGGCGCCGGCGCCGACACGTCGGCGTCCTCCATGGCGTCGTCGTTCCGCACG
CGGCGCGCCTACTTCTACTGGGTGACCCGGGAGCAGGGCTCCTTCGAGTGGTTCCGCGGCGTCATGGACGAGGTGGCCGAGACGGACAAGAAGGGCGTCATCGAGCTCCACAACTACTGC
ACCAGCGTGTACGAGGAAGGCGACGCCCGGTCGGCGCTCATCGCCATGCTCCAGTCGCTCAACCACGCCAAGCACGGCGTCGACGTCGTGTCCGGGACACGCGTCAAGACGCACTTCGCC
AGGCCCAACTGGCGCAACGTCTACAAGCGCATCGCCCTCAACCACCAGAACCAGCGCGTCG
GAGTGTTCTATTGTGGTGCTCCGGTGCTGACAAAGGAGCTGCGCGAGCTCGCGCAGGAT
TTCTCGCGGAAAACCAACACCAAGTTCGAGTTCCACAAGGAGAACTTCTAA

Retrieve as FASTA