Entry information : MguPrx12 (mgv1a009213m)
Entry ID 9182
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx12 (mgv1a009213m)
Name (synonym) MguPrx12 (mgv1a009213m)
Class Class III peroxidase    [Orthogroup: Prx089]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx12
start..stop
S start..stop
MguPrx36 657 0 1..323 1..323
MguPrx39 643 0 1..323 1..322
MguPrx44 642 0 1..325 1..324
MguPrx84 642 0 1..325 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 161033..161245 213 N° 2 161350..161538 189 N° 3 161625..161790 166 N° 4 162026..162435 410
join(161033..161245,161350..161538,161625..161790,162026..162435)


exon

Literature and cross-references MguPrx12 (mgv1a009213m)
DNA ref. Phytozome 12:   scaffold_52 (161033..162435)
Protein sequence: MguPrx12 (mgv1a009213m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   34969.93 (32347.5) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.1 (9.07) Peptide Signal:   %s   cut: 24 range:24-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKQILVFLVLVGIFNISCNAQGLKLGFYKKTCPSAEAIVKKETASIMAVAPTLAAPILRMHFHDCFVRGCDASILLNSTTNNPAEKDSFPNLSLRGYGSIDRVKSAVEKKCPGVVSCADILALVARDAVSLLNGASWPVPLGRRDGNVSNSTEVLFNLPPPFFNITQLKANFASKGLNAKDLVVLSGGHTIGTSHCSSFTNRLYNFTGVGDSDPSLDSNYVARLKTRCSATDTTTLVEMDPGSFKTFDIEYYTLVAKRRGLFTSDAALLADSETRAYVTSHATPQGSKDFLKDFAKSMVKMGKIGVLTGSQGEIRKTCAFIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTATTTCTTGTACTAGTTGGCATATTCAACATATCATGTAATGCTCAAGGATTGAAGCTTGGCTTCTACAAGAAGACTTGTCCATCTGCTGAGGCG
ATCGTGAAAAAGGAAACTGCTAGTATTATGGCCGTTGCTCCAACTCTTGCCGCTCCTATTCTCAGAATGCATTTTCACGATTGTTTTGTTAGG
GTATGTTGACTTAAAATTAAATATCTC
ATATTGCATTTCCATTAACTAAGATGTGTGTGTGTGAATACATGTATATATATTAAGTAGTAACTTTTGTTTTGCAGGGGTGTGACGCTTCTATCCTACTGAATTCGACAACAAATAATC
CAGCTGAGAAAGATTCATTCCCCAATCTATCCCTTAGAGGATATGGATCCATCGATAGAGTGAAATCCGCAGTGGAGAAGAAGTGCCCCGGTGTTGTTTCTTGTGCCGATATATTAGCTC
TCGTTGCACGAGATGCGGTTTCACTT
GTAAGTACTGTAGACGATTACATATATATGTAAATAAAATCTCATTTATATAAGATTATACTTATTTATTTATATGAAATGTATAGTTGAATGG
AGCATCGTGGCCAGTACCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAGGTTTTGTTCAATCTTCCACCTCCCTTCTTCAACATCACTCAATTGAAAGCTAATTTTGCCTC
AAAGGGTTTGAATGCAAAGGATCTTGTTGTTCTCTCAG
GTAATAATTATATACTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGTAACTAACAAAAACCCTAAATTTGCAGGAGGACACACCATAGGAACATCACACTGCTCGAGTTTCACCAACCGCCTGTACAACTTCACCGGCGTAGGAGACAGTGACCCTTCAT
TGGACTCGAACTATGTTGCTCGTTTGAAAACAAGATGCAGTGCGACCGATACCACTACACTTGTCGAAATGGACCCTGGCAGTTTTAAGACATTCGACATCGAGTATTACACTCTTGTTG
CTAAAAGAAGAGGACTTTTCACATCTGACGCGGCTCTTCTTGCTGACAGTGAAACCAGGGCTTACGTCACCAGCCATGCTACACCTCAAGGGTCAAAGGATTTCTTGAAGGACTTTGCAA
AGTCAATGGTCAAAATGGGCAAGATTGGTGTTTTGACAGGGAGCCAGGGTGAAATCAGGAAAACTTGTGCTTTCATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTATTTCTTGTACTAGTTGGCATATTCAACATATCATGTAATGCTCAAGGATTGAAGCTTGGCTTCTACAAGAAGACTTGTCCATCTGCTGAGGCG
ATCGTGAAAAAGGAAACTGCTAGTATTATGGCCGTTGCTCCAACTCTTGCCGCTCCTATTCTCAGAATGCATTTTCACGATTGTTTTGTTAGG
GGGTGTGACGCTTCTATCCTACTGAAT
TCGACAACAAATAATCCAGCTGAGAAAGATTCATTCCCCAATCTATCCCTTAGAGGATATGGATCCATCGATAGAGTGAAATCCGCAGTGGAGAAGAAGTGCCCCGGTGTTGTTTCTTGT
GCCGATATATTAGCTCTCGTTGCACGAGATGCGGTTTCACTT
TTGAATGGAGCATCGTGGCCAGTACCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAGGTTTTGTTCAAT
CTTCCACCTCCCTTCTTCAACATCACTCAATTGAAAGCTAATTTTGCCTCAAAGGGTTTGAATGCAAAGGATCTTGTTGTTCTCTCAG
GAGGACACACCATAGGAACATCACACTGCTCG
AGTTTCACCAACCGCCTGTACAACTTCACCGGCGTAGGAGACAGTGACCCTTCATTGGACTCGAACTATGTTGCTCGTTTGAAAACAAGATGCAGTGCGACCGATACCACTACACTTGTC
GAAATGGACCCTGGCAGTTTTAAGACATTCGACATCGAGTATTACACTCTTGTTGCTAAAAGAAGAGGACTTTTCACATCTGACGCGGCTCTTCTTGCTGACAGTGAAACCAGGGCTTAC
GTCACCAGCCATGCTACACCTCAAGGGTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTCAAAATGGGCAAGATTGGTGTTTTGACAGGGAGCCAGGGTGAAATCAGGAAAACT
TGTGCTTTCATTAATTAA

Retrieve as FASTA