Entry information : MguPrx17 (mgv1a009598m)
Entry ID 9187
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx17 (mgv1a009598m)
Name (synonym) MguPrx17 (mgv1a009598m)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx17
start..stop
S start..stop
GhPrx22 499 6e-180 26..337 26..333
CroPrx19 498 2e-179 1..335 1..329
IbPrx15 489 7e-176 1..335 1..327
LePrx54 485 2e-174 26..335 22..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 202594..202818 225 N° 2 202269..202466 198 N° 3 201989..202154 166 N° 4 201478..201902 425
complement(join(201478..201902,201989..202154,202269..202466,202594..202818))


exon

Literature and cross-references MguPrx17 (mgv1a009598m)
DNA ref. Phytozome 12:   scaffold_75 (202818..201478)
Protein sequence: MguPrx17 (mgv1a009598m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (309)
PWM (Da):   %s   35423.57 (32433.9)  
PI (pH):   %s   4.95 (4.92) Peptide Signal:   %s   cut: 29 range:29-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHSFPSLTLALITTAAILVLQLAPLSEAQLNSSFYSNSCPNVSNIVTTVIQQALQSDPRIGASLLRLHFHDCFVQGCDGSILLDNNVNGTIQSEKDAAPNTNSTRGFDVVDNIKSAVENSCPGVVSCADILALASQSSVSLAGGPSWNVLLGRRDGTSANQAGANTAIPAPFENLTNLTAKFSAVGLNITDLVALSGAHTFGRAQCRLFRNRLYNFSGSGGPDPLLNATYLASLRQICPQNGGGFSVADLDPTTPDTFDANYFSNLQSNQGLLQSDQELFSASAGAQTTLPIVNMFSGNQSAFFQSFVASMINMGNISPLIGVNGEIRSNCRRVNGS*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCTTTTCCTTCATTAACCCTGGCATTAATTACTACAGCCGCCATATTAGTTCTTCAACTTGCTCCACTCTCTGAAGCTCAATTAAACTCATCATTTTACTCGAATTCATGCCCT
AATGTTTCCAATATTGTCACCACTGTAATCCAGCAAGCTTTACAGTCGGATCCTCGTATTGGAGCCAGCCTCCTTCGTCTCCATTTCCACGATTGCTTTGTTCAG
GTCGATCGATCTTCA
CTCCATATATATATATCCACTTGTTCAACAACTTTCCTCCTCCATTAATCATTCAATTTTTTTTTTCATTTATTTAAGAATTTATTGTTGTATATATATGTATAATCACCAGGGATGTGA
TGGATCAATTTTGTTAGACAACAACGTCAACGGAACAATACAGAGCGAGAAAGACGCAGCTCCAAACACAAATTCGACTCGAGGGTTCGATGTTGTGGACAATATTAAGTCCGCCGTTGA
GAATTCTTGCCCAGGCGTTGTGTCGTGTGCAGATATTTTAGCCCTTGCTTCTCAATCTTCTGTTTCCTTG
GTACTACTGCCCACATATGCACCTATTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGATTAATAATGAAGGCAGGAGGTCCATCATGGAATGTATTGTTAGGAAGAAGAGATGGAACAAGTGCAAA
TCAGGCGGGGGCCAATACCGCCATTCCTGCACCTTTCGAGAACTTGACCAATCTCACTGCCAAGTTTTCTGCTGTCGGTTTAAACATTACCGATTTAGTTGCACTATCAG
GTACGNNNNN
NNNNNNNNNNNNNNNNNNGTGTTTCTGTTTTAATAATTATTCTCAAAAATTAAAACACATGCTGCTGCTGCTGCAGGTGCGCACACTTTTGGGCGTGCGCAGTGTAGACTGTTCAGAAAC
AGGCTGTACAATTTCAGCGGCAGCGGCGGCCCCGATCCGTTGCTGAACGCCACCTACTTGGCCAGCCTCCGCCAGATTTGCCCGCAGAACGGCGGCGGATTCTCGGTGGCGGATCTCGAT
CCGACGACTCCCGATACATTCGACGCCAATTATTTCTCAAACTTGCAGAGCAATCAAGGGCTCCTACAGTCCGATCAGGAACTGTTTTCGGCTTCCGCCGGCGCACAGACGACGTTGCCG
ATCGTTAACATGTTTAGCGGGAATCAGAGTGCGTTCTTCCAGAGCTTTGTGGCGTCGATGATTAATATGGGAAATATTAGTCCGTTGATTGGTGTAAATGGAGAGATCAGATCCAATTGC
AGAAGGGTCAATGGGAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCTTTTCCTTCATTAACCCTGGCATTAATTACTACAGCCGCCATATTAGTTCTTCAACTTGCTCCACTCTCTGAAGCTCAATTAAACTCATCATTTTACTCGAATTCATGCCCT
AATGTTTCCAATATTGTCACCACTGTAATCCAGCAAGCTTTACAGTCGGATCCTCGTATTGGAGCCAGCCTCCTTCGTCTCCATTTCCACGATTGCTTTGTTCAG
GGATGTGATGGATCA
ATTTTGTTAGACAACAACGTCAACGGAACAATACAGAGCGAGAAAGACGCAGCTCCAAACACAAATTCGACTCGAGGGTTCGATGTTGTGGACAATATTAAGTCCGCCGTTGAGAATTCT
TGCCCAGGCGTTGTGTCGTGTGCAGATATTTTAGCCCTTGCTTCTCAATCTTCTGTTTCCTTG
GCAGGAGGTCCATCATGGAATGTATTGTTAGGAAGAAGAGATGGAACAAGTGCAAAT
CAGGCGGGGGCCAATACCGCCATTCCTGCACCTTTCGAGAACTTGACCAATCTCACTGCCAAGTTTTCTGCTGTCGGTTTAAACATTACCGATTTAGTTGCACTATCAG
GTGCGCACACT
TTTGGGCGTGCGCAGTGTAGACTGTTCAGAAACAGGCTGTACAATTTCAGCGGCAGCGGCGGCCCCGATCCGTTGCTGAACGCCACCTACTTGGCCAGCCTCCGCCAGATTTGCCCGCAG
AACGGCGGCGGATTCTCGGTGGCGGATCTCGATCCGACGACTCCCGATACATTCGACGCCAATTATTTCTCAAACTTGCAGAGCAATCAAGGGCTCCTACAGTCCGATCAGGAACTGTTT
TCGGCTTCCGCCGGCGCACAGACGACGTTGCCGATCGTTAACATGTTTAGCGGGAATCAGAGTGCGTTCTTCCAGAGCTTTGTGGCGTCGATGATTAATATGGGAAATATTAGTCCGTTG
ATTGGTGTAAATGGAGAGATCAGATCCAATTGCAGAAGGGTCAATGGGAGCTAA

Retrieve as FASTA