Entry information : SbKat01 ( Sobic.004G011566 [3.1]/Sobic.004G011500.1[2.1] / Sb04g001130[1.4])
Entry ID 919
Creation 2008-10-23 (Christophe Dunand)
Last sequence changes 2016-02-16 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-16 (Achraf Jemmat)
Peroxidase information: SbKat01 ( Sobic.004G011566 [3.1]/Sobic.004G011500.1[2.1] / Sb04g001130[1.4])
Name (synonym) SbKat01 ( Sobic.004G011566 [3.1]/Sobic.004G011500.1[2.1] / Sb04g001130[1.4])
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Germinated embryos
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbKat01
start..stop
S start..stop
SpKat01 1025 0 1..493 1..493
ZmKat3 970 0 1..493 2..495
OsKat01 908 0 1..493 1..492
CclKat01 803 0 1..493 1..493
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 968518..968532 15 N° 2 966891..968297 1407 N° 3 966716..966775 60  
complement(join(966716..966775,966891..968297,968518..968532))


exon

Literature and cross-references SbKat01 ( Sobic.004G011566 [3.1]/Sobic.004G011500.1[2.1] / Sb04g001130[1.4])
Literature Reid,S.P. et al., unpublished
DNA ref. JGI genome:   chr04 (966711..968582)
Cluster/Prediction ref. UniGene:   sbi.17797
Protein sequence: SbKat01 ( Sobic.004G011566 [3.1]/Sobic.004G011500.1[2.1] / Sb04g001130[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   493
PWM (Da):   %s   56388.15  
PI (pH):   %s   6.99
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPTKFRPSSSHDTTVTTTNAGAPVWNDNEALTVGPRGPILLEDYHLIEKVAHFARERIPERVVHARGASAKGFFECTHDVASLTCADFLRSPGVRTPVIVRFSTVIHERGSPETIRDPRGFAVKFYTREGNWDLLGNNFPVFFIRDGIKFPDVIHAFKPNPRSHVQEYWRVFDFLSHLPESLHTFFFLFDDVGVPTDYRHMEGFGVNTYTFVNAAGKSHYVKFHWKPTCGVRSILTDEEAALVGGRNHSHATQDLYDSIAAGSFPEWKLFVQVMDPDTEDQYDFDPLDDTKTWPEDLLPLQPVGRLVLDKNVDNFFNENEQLAFGPGLVVPGIYYSDDKMLQCRVFAYADTQRYRLGPNYLMLPVNAPRCAHHNNHYDGAMNFMHRDEEVDYYPSRHAPLRQAPPVPIPARPVVGKRQKETIRKPNDFKQPGERYRSWDADRQERFVRRFADSLGHPKVSQELRSIWIDLLSKCDASLGMKIATRLNMKPNM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 2 introns) and 350 ESTs. Unigene is a compile of Kat01, 02.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCACCAAGGTGAGCTCAAGCTTCTTAATTATTCCTATAGCTGCTCCATGGATACCTATCTAATGAAGCTACTTTAATTTGTTGATTTTTATAAACTTATATATATACATATAT
AGAAATCATATCATATATACTACTGTATGATGGATGCATGCATGATGCCCTGTTCATGCACTCGCGAATGAATAATGGACATATATATATATATATATATATATGCATCATGCAGTTCCG
TCCGTCGAGCAGCCACGACACGACGGTGACGACGACGAACGCCGGAGCGCCGGTGTGGAACGACAACGAGGCGCTGACGGTGGGCCCGCGCGGGCCGATCCTGCTGGAGGACTACCACCT
GATCGAGAAGGTGGCGCACTTCGCCCGGGAGCGCATCCCGGAGCGCGTCGTCCACGCGCGCGGCGCCTCCGCCAAGGGCTTCTTCGAGTGCACCCACGACGTGGCGTCGCTGACCTGCGC
CGACTTCCTCCGCTCCCCGGGCGTCCGGACCCCCGTCATCGTCCGCTTCTCCACGGTGATCCACGAGCGCGGCTCGCCGGAGACGATCCGCGACCCGCGCGGGTTCGCCGTCAAGTTCTA
CACCAGGGAGGGCAACTGGGACCTCCTGGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGGATCAAGTTCCCCGACGTGATCCACGCGTTCAAGCCCAACCCGAGATCGCATGTGCA
GGAGTACTGGCGCGTGTTCGATTTTTTGTCGCATCTCCCCGAGAGCCTCCACACCTTCTTCTTCCTCTTCGACGACGTCGGCGTGCCGACGGACTACCGCCACATGGAAGGCTTCGGCGT
CAACACCTACACCTTCGTCAACGCCGCCGGCAAGTCCCACTACGTCAAGTTCCACTGGAAGCCGACGTGCGGCGTCCGGAGCATCCTCACCGACGAGGAAGCGGCGTTGGTCGGCGGGAG
GAACCACAGCCACGCCACGCAGGACCTCTACGACTCCATCGCCGCCGGCAGCTTCCCGGAGTGGAAGCTGTTCGTGCAGGTGATGGACCCGGACACGGAGGACCAGTACGATTTCGACCC
GCTCGACGACACCAAGACATGGCCGGAGGATCTGCTGCCACTCCAGCCCGTGGGGAGGCTGGTGCTGGACAAGAACGTGGACAATTTCTTCAACGAGAACGAGCAGCTGGCGTTCGGACC
GGGGCTGGTGGTGCCGGGGATCTACTACTCCGACGACAAGATGCTGCAGTGCCGGGTGTTCGCGTACGCCGACACGCAGCGCTACAGGCTGGGGCCCAACTACCTGATGCTCCCGGTGAA
CGCGCCGCGATGCGCGCACCATAACAACCACTACGACGGCGCCATGAACTTCATGCACCGGGACGAGGAGGTGGACTACTACCCGTCCAGGCACGCGCCGCTCCGGCAGGCGCCGCCGGT
GCCGATCCCGGCGAGGCCGGTGGTGGGGAAGAGGCAGAAGGAGACCATACGGAAGCCGAATGATTTCAAGCAGCCTGGGGAGAGGTACCGGAGCTGGGACGCCGATCGGCAGGAGAGGTT
TGTGCGGCGGTTTGCTGACTCGCTGGGGCATCCAAAGGTTAGCCAGGAGCTCAGGTCCATCTGGATCGACCTCCTCTCAAAG
GTAAATAACATATCTATATACTGAAAAATCAAATCTTT
TTTTTCTTTTTTTACGGCATGCACGGTTTATGAAGCTAGCTTAGTAATCTCTGGATGGCATATGTATGTGCATGCAGTGCGACGCATCGCTGGGGATGAAGATTGCCACACGGCTCAACA
TGAAGCCAAACATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCACCAAGTTCCGTCCGTCGAGCAGCCACGACACGACGGTGACGACGACGAACGCCGGAGCGCCGGTGTGGAACGACAACGAGGCGCTGACGGTGGGCCCGCGCGGGCCGATC
CTGCTGGAGGACTACCACCTGATCGAGAAGGTGGCGCACTTCGCCCGGGAGCGCATCCCGGAGCGCGTCGTCCACGCGCGCGGCGCCTCCGCCAAGGGCTTCTTCGAGTGCACCCACGAC
GTGGCGTCGCTGACCTGCGCCGACTTCCTCCGCTCCCCGGGCGTCCGGACCCCCGTCATCGTCCGCTTCTCCACGGTGATCCACGAGCGCGGCTCGCCGGAGACGATCCGCGACCCGCGC
GGGTTCGCCGTCAAGTTCTACACCAGGGAGGGCAACTGGGACCTCCTGGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGGATCAAGTTCCCCGACGTGATCCACGCGTTCAAGCCC
AACCCGAGATCGCATGTGCAGGAGTACTGGCGCGTGTTCGATTTTTTGTCGCATCTCCCCGAGAGCCTCCACACCTTCTTCTTCCTCTTCGACGACGTCGGCGTGCCGACGGACTACCGC
CACATGGAAGGCTTCGGCGTCAACACCTACACCTTCGTCAACGCCGCCGGCAAGTCCCACTACGTCAAGTTCCACTGGAAGCCGACGTGCGGCGTCCGGAGCATCCTCACCGACGAGGAA
GCGGCGTTGGTCGGCGGGAGGAACCACAGCCACGCCACGCAGGACCTCTACGACTCCATCGCCGCCGGCAGCTTCCCGGAGTGGAAGCTGTTCGTGCAGGTGATGGACCCGGACACGGAG
GACCAGTACGATTTCGACCCGCTCGACGACACCAAGACATGGCCGGAGGATCTGCTGCCACTCCAGCCCGTGGGGAGGCTGGTGCTGGACAAGAACGTGGACAATTTCTTCAACGAGAAC
GAGCAGCTGGCGTTCGGACCGGGGCTGGTGGTGCCGGGGATCTACTACTCCGACGACAAGATGCTGCAGTGCCGGGTGTTCGCGTACGCCGACACGCAGCGCTACAGGCTGGGGCCCAAC
TACCTGATGCTCCCGGTGAACGCGCCGCGATGCGCGCACCATAACAACCACTACGACGGCGCCATGAACTTCATGCACCGGGACGAGGAGGTGGACTACTACCCGTCCAGGCACGCGCCG
CTCCGGCAGGCGCCGCCGGTGCCGATCCCGGCGAGGCCGGTGGTGGGGAAGAGGCAGAAGGAGACCATACGGAAGCCGAATGATTTCAAGCAGCCTGGGGAGAGGTACCGGAGCTGGGAC
GCCGATCGGCAGGAGAGGTTTGTGCGGCGGTTTGCTGACTCGCTGGGGCATCCAAAGGTTAGCCAGGAGCTCAGGTCCATCTGGATCGACCTCCTCTCAAAG
TGCGACGCATCGCTGGGG
ATGAAGATTGCCACACGGCTCAACATGAAGCCAAACATGTGA

Retrieve as FASTA