Entry information : MguPrx20 (mgv1a009720m)
Entry ID 9190
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx20 (mgv1a009720m)
Name (synonym) MguPrx20 (mgv1a009720m)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx20
start..stop
S start..stop
RcPrx17 557 0 8..333 7..331
MePrx01 552 0 1..333 1..331
LcPrx03 552 0 1..333 1..332
LePrx67 552 0 1..332 1..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4129108..4129338 231 N° 2 4128729..4128920 192 N° 3 4128472..4128637 166 N° 4 4127768..4128180 413
complement(join(4127768..4128180,4128472..4128637,4128729..4128920,4129108..4129 338))


exon

Literature and cross-references MguPrx20 (mgv1a009720m)
DNA ref. Phytozome 12:   scaffold_3 (4129338..4127768)
Protein sequence: MguPrx20 (mgv1a009720m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (310)
PWM (Da):   %s   36415.71 (33852.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.28 (9.40) Peptide Signal:   %s   cut: 24 range:24-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKSINFVFLILALLAFAPLCLCHVNTFGGYLYPQFYDRSCPQAQQIVNSVVSKAVAREARMAASLVRLHFHDCFVKGCDASILLDSASGIISEKGSKPNKNSIRGLEVIDEIKSELEKQCPHTVSCADIMALAARDSTVLAGGPSWVVPLGRRDSKGASLSGSNNNIPAPNNTFQTILTKFKLQGLDIVDLVALSGSHTIGNARCVSFRQRLYNQSGNSKPDPTLDQSYAATLRTRCPKFGGDQNLSFLDLVSPTKFDNSYFKNLLSFKGLLSSDQILVTKNQVSFELVKKYAESNEVFFEQFAKSMVKMGNISPLTGFKGEIRSNCRKINA*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAATCCATCAACTTTGTGTTCTTGATTTTAGCTCTTCTTGCTTTTGCACCTCTTTGCTTATGTCATGTTAACACCTTTGGAGGCTACCTATACCCTCAATTCTACGACCGCTCT
TGCCCGCAAGCTCAACAAATCGTTAACTCTGTCGTTTCAAAAGCCGTTGCTAGAGAAGCCCGTATGGCTGCTTCTCTTGTTAGGCTTCATTTTCATGATTGCTTTGTCAAG
GTTTTTTTG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGACTTATCTTGCCGGCCAGCCAAACGAGTCGTTAGTGTAATGATCATATATGTACTACATT
ACTAATAGGGTTACGTTCTTTATCTTATCCATCTTCTTGATATTTTATATGTATGAAGGGATGCGATGCATCGATACTATTGGACAGCGCTTCGGGCATCATAAGCGAAAAGGGTTCGAA
GCCCAACAAGAATTCAATTCGCGGGCTTGAAGTGATCGATGAAATCAAATCAGAGCTAGAAAAACAGTGCCCTCATACCGTTTCTTGTGCCGATATCATGGCTCTTGCTGCTAGAGATTC
CACTGTTCTC
GTAAGTCCGAANNNNNNNNNNNNNNNNNNNNNNNTTATTGCATTATACAAGTATACATGCATTAGAAATAACTTTGTATAATTAAATGTAGGCCGGTGGTCCGAGTTGGG
TGGTTCCGTTGGGAAGAAGAGACTCGAAAGGAGCCAGTTTGAGTGGCTCGAACAACAACATTCCTGCCCCGAACAACACTTTTCAGACAATTCTCACCAAGTTTAAGTTACAAGGATTAG
ACATTGTTGATCTTGTTGCCTTATCTG
GTACATACACTTTTTCTCCACCCATTTTATTACAACAATTACTATTACATTACAAATTAAGCTTCATTATGATNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAACAAAAATCTATACATAAAAATAGTAGATTCTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGGAGGGGGGCCACGGCCCCTTTTGCATGATAACTAATCGATCCTATATATCTCAATTCTTCTTGCAGGAAGCCACACTATAGGGAATGCAAGATGTGTCAGCTTCAGAC
AGAGGCTGTACAACCAATCGGGGAACTCGAAGCCCGATCCCACACTCGACCAATCGTACGCCGCCACCTTGCGTACCCGTTGCCCGAAATTCGGTGGGGATCAGAATCTGTCGTTCTTGG
ACTTGGTATCTCCCACAAAGTTTGACAACAGCTATTTCAAGAATCTGCTGAGTTTTAAGGGGCTTTTGAGTTCTGACCAAATTCTCGTGACGAAGAATCAAGTTTCTTTCGAGCTCGTGA
AGAAGTACGCTGAGAGCAACGAGGTTTTCTTCGAGCAGTTTGCCAAATCTATGGTGAAGATGGGGAATATTTCTCCATTGACTGGTTTTAAGGGAGAGATTAGGAGCAACTGCAGAAAGA
TTAATGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAATCCATCAACTTTGTGTTCTTGATTTTAGCTCTTCTTGCTTTTGCACCTCTTTGCTTATGTCATGTTAACACCTTTGGAGGCTACCTATACCCTCAATTCTACGACCGCTCT
TGCCCGCAAGCTCAACAAATCGTTAACTCTGTCGTTTCAAAAGCCGTTGCTAGAGAAGCCCGTATGGCTGCTTCTCTTGTTAGGCTTCATTTTCATGATTGCTTTGTCAAG
GGATGCGAT
GCATCGATACTATTGGACAGCGCTTCGGGCATCATAAGCGAAAAGGGTTCGAAGCCCAACAAGAATTCAATTCGCGGGCTTGAAGTGATCGATGAAATCAAATCAGAGCTAGAAAAACAG
TGCCCTCATACCGTTTCTTGTGCCGATATCATGGCTCTTGCTGCTAGAGATTCCACTGTTCTC
GCCGGTGGTCCGAGTTGGGTGGTTCCGTTGGGAAGAAGAGACTCGAAAGGAGCCAGT
TTGAGTGGCTCGAACAACAACATTCCTGCCCCGAACAACACTTTTCAGACAATTCTCACCAAGTTTAAGTTACAAGGATTAGACATTGTTGATCTTGTTGCCTTATCTG
GAAGCCACACT
ATAGGGAATGCAAGATGTGTCAGCTTCAGACAGAGGCTGTACAACCAATCGGGGAACTCGAAGCCCGATCCCACACTCGACCAATCGTACGCCGCCACCTTGCGTACCCGTTGCCCGAAA
TTCGGTGGGGATCAGAATCTGTCGTTCTTGGACTTGGTATCTCCCACAAAGTTTGACAACAGCTATTTCAAGAATCTGCTGAGTTTTAAGGGGCTTTTGAGTTCTGACCAAATTCTCGTG
ACGAAGAATCAAGTTTCTTTCGAGCTCGTGAAGAAGTACGCTGAGAGCAACGAGGTTTTCTTCGAGCAGTTTGCCAAATCTATGGTGAAGATGGGGAATATTTCTCCATTGACTGGTTTT
AAGGGAGAGATTAGGAGCAACTGCAGAAAGATTAATGCTTGA

Retrieve as FASTA