Entry information : MguPrx30 (mgv1a009833m)
Entry ID 9199
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx30 (mgv1a009833m)
Name (synonym) MguPrx30 (mgv1a009833m)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx30
start..stop
S start..stop
MguPrx31 606 0 1..330 1..330
PpePrx17 515 0 12..330 8..326
RcPrx06 509 0 2..330 1..329
VvPrx18 506 0 25..330 21..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 412323..412544 222 N° 2 412744..412941 198 N° 3 413044..413209 166 N° 4 413843..414246 404
join(412323..412544,412744..412941,413044..413209,413843..414246)


exon

Literature and cross-references MguPrx30 (mgv1a009833m)
DNA ref. Phytozome 12:   scaffold_188 (412323..414246)
Protein sequence: MguPrx30 (mgv1a009833m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (303)
PWM (Da):   %s   35691.09 (32807.5)  
PI (pH):   %s   9.39 (9.17) Peptide Signal:   %s   cut: 28 range:28-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMNQKSTSLMTLLPLIVVLVISNTANAQLRTNFYNATCPNVEALVRAAVQAKFRQTFVTAPATLRLFFHDCFVRGCDASVMMASPTGNAEKDHPDNLSLAGDGFDTVIRAKAAVDRNTNCTNKVSCADILALATRDVVALVGGPSYSVELGRRDGRISTRASVQGRLPGPGFSLNQLNTLFASHGLDQTDVVALSGAHTIGFSHCNRFSRRIYNFSPANRIDPSLNLQYALQLRQMCPVNVDPTIAVNMDPTSPNRFDNAYFRNLQGGRGLFTSDQVLFTDTRSRATVNQFALNNAAFGRAFVLAMTKLGRVGVLTGNQGEIRIDCTTP

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAACCAAAAATCAACAAGTTTAATGACCCTTTTGCCCCTGATTGTTGTCCTTGTAATTAGCAACACAGCCAATGCTCAGCTTAGAACTAATTTCTACAATGCAACATGCCCTAAT
GTTGAGGCCCTTGTTCGTGCCGCCGTTCAGGCCAAATTCCGGCAGACTTTCGTCACCGCTCCGGCCACCCTCCGCCTCTTCTTCCACGACTGCTTCGTTAGG
GTTCGTCTTTTCTTTCTT
TCTCTATATATATATGCATACAAAAAATGATCAACTTTTCATGACATTAATTTCAAGAAACATTTTTTTCTTGACCTAGCTGTTAATTAAAAACCCTCTAATTTTTCATGTTAAATAATT
TTCTTTTCTTGGCTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTGTGACGCATCGGTTATGATGGCATCGCCGACCGGAAATGCGGAGAAGGACCATCC
GGATAACCTATCTCTCGCGGGAGACGGTTTCGACACTGTTATTCGGGCAAAGGCTGCCGTCGACAGAAATACTAATTGCACAAACAAAGTTTCGTGTGCCGATATATTAGCGTTGGCCAC
AAGAGACGTTGTCGCCTTG
GTACGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCTTAATATATACTATTGGCATTAGTGAAAACAAGAGCGGTGATCGTACGAAATTACTACGTGCA
GGTCGGAGGGCCGTCGTATTCGGTGGAATTGGGAAGAAGAGACGGGAGAATATCGACTCGTGCCAGCGTACAAGGCCGTCTTCCGGGACCAGGGTTTAGTTTGAACCAACTCAACACCTT
GTTTGCCAGTCATGGCCTAGACCAAACTGATGTCGTTGCATTATCAG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNCGCCTCAAATTTTTTTTAAAAAGA
ATTATTCATAAAATGTAGTACAAAATAAATAAATGCATTGAAAACTAGTAAATAGTGGAAACACATTTAATTGAGAGTGGGTTGGAGTTCACTGCTGCCAAAAGATAGATCATTTGTGTA
TATATATATCCTCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCTCGTTATACGTCTTAATTAAATTATTAGGCGCGCACACAATTGGATTCTCACACTGCAACCGTTTCTC
GAGGAGAATCTACAACTTCAGCCCGGCAAACAGAATCGACCCGTCGCTCAACCTCCAGTACGCATTGCAGCTTCGACAAATGTGCCCCGTGAATGTGGACCCCACAATCGCCGTCAACAT
GGACCCCACTTCCCCAAACAGATTCGACAACGCTTACTTCCGGAACCTTCAAGGAGGAAGAGGCCTCTTTACTTCCGATCAAGTCCTCTTTACCGATACTCGTTCGAGAGCCACCGTTAA
TCAATTTGCTTTGAACAATGCTGCTTTTGGCAGAGCATTTGTGCTGGCTATGACTAAGCTTGGTAGAGTTGGGGTGCTCACTGGTAACCAGGGTGAGATCAGAATTGACTGCACTACGCC
AAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAACCAAAAATCAACAAGTTTAATGACCCTTTTGCCCCTGATTGTTGTCCTTGTAATTAGCAACACAGCCAATGCTCAGCTTAGAACTAATTTCTACAATGCAACATGCCCTAAT
GTTGAGGCCCTTGTTCGTGCCGCCGTTCAGGCCAAATTCCGGCAGACTTTCGTCACCGCTCCGGCCACCCTCCGCCTCTTCTTCCACGACTGCTTCGTTAGG
GGTTGTGACGCATCGGTT
ATGATGGCATCGCCGACCGGAAATGCGGAGAAGGACCATCCGGATAACCTATCTCTCGCGGGAGACGGTTTCGACACTGTTATTCGGGCAAAGGCTGCCGTCGACAGAAATACTAATTGC
ACAAACAAAGTTTCGTGTGCCGATATATTAGCGTTGGCCACAAGAGACGTTGTCGCCTTG
GTCGGAGGGCCGTCGTATTCGGTGGAATTGGGAAGAAGAGACGGGAGAATATCGACTCGT
GCCAGCGTACAAGGCCGTCTTCCGGGACCAGGGTTTAGTTTGAACCAACTCAACACCTTGTTTGCCAGTCATGGCCTAGACCAAACTGATGTCGTTGCATTATCAG
GCGCGCACACAATT
GGATTCTCACACTGCAACCGTTTCTCGAGGAGAATCTACAACTTCAGCCCGGCAAACAGAATCGACCCGTCGCTCAACCTCCAGTACGCATTGCAGCTTCGACAAATGTGCCCCGTGAAT
GTGGACCCCACAATCGCCGTCAACATGGACCCCACTTCCCCAAACAGATTCGACAACGCTTACTTCCGGAACCTTCAAGGAGGAAGAGGCCTCTTTACTTCCGATCAAGTCCTCTTTACC
GATACTCGTTCGAGAGCCACCGTTAATCAATTTGCTTTGAACAATGCTGCTTTTGGCAGAGCATTTGTGCTGGCTATGACTAAGCTTGGTAGAGTTGGGGTGCTCACTGGTAACCAGGGT
GAGATCAGAATTGACTGCACTACGCCAAAT

Retrieve as FASTA