Entry information : MguPrx31 (mgv1a009838m)
Entry ID 9200
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx31 (mgv1a009838m)
Name (synonym) MguPrx31 (mgv1a009838m)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx31
start..stop
S start..stop
MguPrx30 606 0 1..330 1..330
PpePrx17 524 0 9..330 5..326
LePrx48 518 0 1..330 1..329
CroPrx26 508 0 15..330 13..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 452755..452976 222 N° 2 453087..453284 198 N° 3 453375..453540 166 N° 4 454490..454893 404
join(452755..452976,453087..453284,453375..453540,454490..454893)


exon

Literature and cross-references MguPrx31 (mgv1a009838m)
DNA ref. Phytozome 11:   scaffold_188 (452755..454893)
Protein sequence: MguPrx31 (mgv1a009838m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (303)
PWM (Da):   %s   35694.06 (32770.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.61 (9.39) Peptide Signal:   %s   cut: 28 range:28-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMNQKTIISMTILPLVIILVISNTANAQLRTNFYSATCPNVEALVRAAVQTKFRQTFVTAPATLRLFFHDCFVRGCDASIMIASPNGNAEKDHPDNLSLAGDGFDTVIKAKAAVDRNSQCRNKVSCADILALATRDVVVLAGGASYPVELGRRDGRISTSASVQGRLPGPGFSLNQLNTMFASHGLDQTDLIALSGAHTIGFSHCNRFSNRIYNFSPSRRVDPSLNPQYATQLRQMCPINVDPRIAINMDPTSANTFDNAYFRNLQGGRGLFTSDQVLFTDTRSRATVNQFASNNAAFGRAFGLAMTKLGRVGVLTGNQGEIRIDCTRP

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAATCAAAAAACAATAATTTCCATGACCATTTTGCCCCTAGTTATTATCCTTGTGATTAGTAACACAGCCAATGCTCAACTTAGAACTAATTTCTACAGCGCAACATGCCCTAAT
GTTGAGGCCCTCGTTCGTGCCGCGGTTCAAACCAAATTCCGCCAGACTTTTGTCACCGCTCCGGCCACCCTCCGCCTCTTCTTCCACGACTGCTTCGTTCGG
GTATACCTTTTCTTCCTT
CTTNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAATAATAAATTGTTCAACTTTTCATGATTCTTGATCAATATGATCATATATACATATAGGGATGTGACGCATCGATTATGATAGCAT
CGCCGAACGGAAACGCGGAGAAGGACCATCCAGATAACCTATCTCTAGCAGGAGACGGTTTCGACACGGTTATTAAGGCAAAAGCTGCCGTTGACCGAAATTCCCAATGCAGAAACAAAG
TTTCGTGTGCTGATATATTAGCATTAGCCACAAGAGATGTTGTCGTCTTG
GTACGTNNNNNNNNNNNNNNNNNNNNNNNTATGAATTCAAGATNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGTAATTTGTGCAGGCTGGAGGGGCGTCGTACCCGGTGGAATTGGGAAGAAGAGACGGGAGAATATCGACTAGTGCAAGCGTACAAGGCCGTCTTCCGGGACCGGGATTTAGCT
TGAACCAACTCAATACCATGTTTGCAAGTCATGGCCTAGACCAAACTGATTTAATTGCATTATCAG
GNNNNNNNNNNNNNNNNNNNNNCACCTCACACAACTCATATATATATATATTCT
TTGTCCTTGTGTTTGTATGTATGTATGTTGTCTAGTATAGGTACATATTTATTCTCTTACAGTTACAGTTCATTTTATTACATGGATTATTCCATGCTACATCCGATGAATTTTATACAT
TCAAATGTATATGTATGTCACTGTGTCTAAATTAAAATTAGAAAACTAATTTGATGTACTATGATACCTAGCTAGCTAATACCTTACCCTAATTAAAAATCATGGAGAATTAAATGATAT
AATTATTTTGGACTAATGTTGGCACGATAGTGATCATTGCATTCATTCCCCTTTACAAATACCTTTTTTCTTTGAGATATACTTTACATGTGCTCATCACATGCGATGGACCCCAGGATT
AGGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTATATCTCTCGTACTTTGGTGTTAATTACTATAAAGGTGCACACACGATCGGATTCTCCCACTGCAACCGTTTCTCCAACCGTATCTACAACTTCAGCCCA
TCGAGACGGGTTGACCCGTCACTGAACCCGCAATATGCAACCCAGCTTCGGCAAATGTGCCCGATCAATGTTGACCCTAGAATCGCGATCAACATGGACCCCACATCCGCAAACACATTC
GACAACGCCTACTTCCGTAACCTACAAGGAGGAAGAGGGCTATTCACCTCCGATCAAGTCCTCTTCACCGATACTCGATCGAGAGCCACCGTTAATCAATTTGCATCGAACAATGCCGCT
TTTGGCAGAGCATTTGGCCTGGCCATGACTAAGCTTGGTAGAGTTGGGGTGCTCACTGGTAACCAGGGTGAAATCAGAATTGATTGCACTAGGCCAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAATCAAAAAACAATAATTTCCATGACCATTTTGCCCCTAGTTATTATCCTTGTGATTAGTAACACAGCCAATGCTCAACTTAGAACTAATTTCTACAGCGCAACATGCCCTAAT
GTTGAGGCCCTCGTTCGTGCCGCGGTTCAAACCAAATTCCGCCAGACTTTTGTCACCGCTCCGGCCACCCTCCGCCTCTTCTTCCACGACTGCTTCGTTCGG
GGATGTGACGCATCGATT
ATGATAGCATCGCCGAACGGAAACGCGGAGAAGGACCATCCAGATAACCTATCTCTAGCAGGAGACGGTTTCGACACGGTTATTAAGGCAAAAGCTGCCGTTGACCGAAATTCCCAATGC
AGAAACAAAGTTTCGTGTGCTGATATATTAGCATTAGCCACAAGAGATGTTGTCGTCTTG
GCTGGAGGGGCGTCGTACCCGGTGGAATTGGGAAGAAGAGACGGGAGAATATCGACTAGT
GCAAGCGTACAAGGCCGTCTTCCGGGACCGGGATTTAGCTTGAACCAACTCAATACCATGTTTGCAAGTCATGGCCTAGACCAAACTGATTTAATTGCATTATCAG
GTGCACACACGATC
GGATTCTCCCACTGCAACCGTTTCTCCAACCGTATCTACAACTTCAGCCCATCGAGACGGGTTGACCCGTCACTGAACCCGCAATATGCAACCCAGCTTCGGCAAATGTGCCCGATCAAT
GTTGACCCTAGAATCGCGATCAACATGGACCCCACATCCGCAAACACATTCGACAACGCCTACTTCCGTAACCTACAAGGAGGAAGAGGGCTATTCACCTCCGATCAAGTCCTCTTCACC
GATACTCGATCGAGAGCCACCGTTAATCAATTTGCATCGAACAATGCCGCTTTTGGCAGAGCATTTGGCCTGGCCATGACTAAGCTTGGTAGAGTTGGGGTGCTCACTGGTAACCAGGGT
GAAATCAGAATTGATTGCACTAGGCCAAAT

Retrieve as FASTA