Entry information : MguPrx32 (mgv1a009839m)
Entry ID 9201
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx32 (mgv1a009839m)
Name (synonym) MguPrx32 (mgv1a009839m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx32
start..stop
S start..stop
CanPrx01 514 0 3..330 4..332
SaPrx30 509 0 1..330 1..324
StPrx28 503 0 3..330 5..331
GhPrx06 499 5e-180 12..330 10..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 733080..733490 411 N° 2 733742..733904 163 N° 3 734087..734502 416  
join(733080..733490,733742..733904,734087..734502)


exon

Literature and cross-references MguPrx32 (mgv1a009839m)
DNA ref. Phytozome 12:   scaffold_89 (733080..734502)
Protein sequence: MguPrx32 (mgv1a009839m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (302)
PWM (Da):   %s   35469.99 (32438.4)  
PI (pH):   %s   8.21 (8.20) Peptide Signal:   %s   cut: 29 range:29-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFHNMNQQLLVPMFLLLVATFAGLSSGQGATRLAFYARTCPRVESIVQSTVRTHFNADRTVAPGLLRMLFHDCFVQGCDASILIDGAGTEKTAGPNLLLRGYEVIDDAKRQLETACPGVVSCADILALAARDSVVLAGGPSWAVPTGRRDGLVSLASETSNLPGFTESVDSLKRKFLDKGLNTQDLVTLSGGHTIGTSACQFFRYRLYNFNSTGGPDPTIAAAFLPTLRALCPDGGDGSRRIGLDNGSENRFDNTYFANLRNGRGILESDQKLWTDSSTNTFVQRYLGVRGLLGLTFSVEFGRSMVKMSNIEVKTGTNGEIRRVCSAI

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTTCATAACATGAATCAACAACTTCTTGTTCCAATGTTCTTGTTACTAGTTGCTACGTTCGCGGGCTTGTCCTCCGGGCAAGGAGCCACGAGGCTGGCTTTCTACGCGAGGACT
TGTCCTCGCGTAGAGTCCATCGTACAATCCACCGTCCGTACGCATTTCAACGCCGACCGTACGGTGGCACCGGGGCTATTGAGAATGCTCTTCCACGACTGCTTCGTTCAGGGCTGCGAC
GCTTCCATCCTCATTGATGGGGCCGGCACCGAAAAAACCGCGGGCCCCAATCTTCTCCTCAGAGGATATGAGGTCATCGACGACGCCAAGCGCCAGCTGGAGACTGCATGCCCCGGCGTC
GTCTCGTGCGCCGACATTCTCGCTCTTGCTGCCCGTGATTCCGTTGTGCTG
GTAATTAACCCATACAGTAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATACATATCTG
TGTGTGCGCGCGCATGGAGTTTTGGAATTGGAGAGGTTTTAATTTTTTTTTCTTTTATGCAGGCTGGTGGGCCGAGTTGGGCGGTGCCAACGGGGCGAAGAGACGGGCTCGTATCGTTAG
CGAGTGAAACGTCGAATTTGCCGGGTTTTACGGAGTCCGTTGATTCGCTGAAACGGAAGTTTCTCGATAAAGGTCTCAACACTCAAGATCTTGTCACCCTTTCTG
GTAAGCACACATAAT
TTAATGATTTTAGTTTCCATCTACAATTTAGACACAATCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAATTAGTTGATGATGAAGATTTTA
ATTAAACTAAAACAGAGAAAAATCTAAACTGATTTTAATTTTTGAAGGGGGGCATACCATTGGCACCAGCGCCTGCCAGTTCTTCCGTTACAGGCTGTACAATTTCAATTCCACCGGTGG
GCCCGACCCCACCATCGCTGCCGCATTTCTTCCTACACTCCGGGCACTTTGTCCGGATGGCGGAGATGGGTCCCGCCGGATAGGGCTCGACAACGGCAGCGAAAACCGGTTCGACAACAC
GTACTTCGCCAACTTGAGGAACGGCCGTGGAATTCTTGAATCGGATCAGAAACTATGGACCGATAGCTCGACCAACACTTTTGTTCAGAGGTATCTGGGGGTGAGGGGTTTGTTGGGGTT
GACTTTCAGCGTCGAATTCGGAAGGTCGATGGTGAAGATGAGTAATATTGAAGTCAAGACGGGGACTAACGGTGAAATTCGTAGGGTTTGCTCTGCTATTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTTCATAACATGAATCAACAACTTCTTGTTCCAATGTTCTTGTTACTAGTTGCTACGTTCGCGGGCTTGTCCTCCGGGCAAGGAGCCACGAGGCTGGCTTTCTACGCGAGGACT
TGTCCTCGCGTAGAGTCCATCGTACAATCCACCGTCCGTACGCATTTCAACGCCGACCGTACGGTGGCACCGGGGCTATTGAGAATGCTCTTCCACGACTGCTTCGTTCAGGGCTGCGAC
GCTTCCATCCTCATTGATGGGGCCGGCACCGAAAAAACCGCGGGCCCCAATCTTCTCCTCAGAGGATATGAGGTCATCGACGACGCCAAGCGCCAGCTGGAGACTGCATGCCCCGGCGTC
GTCTCGTGCGCCGACATTCTCGCTCTTGCTGCCCGTGATTCCGTTGTGCTG
GCTGGTGGGCCGAGTTGGGCGGTGCCAACGGGGCGAAGAGACGGGCTCGTATCGTTAGCGAGTGAAACG
TCGAATTTGCCGGGTTTTACGGAGTCCGTTGATTCGCTGAAACGGAAGTTTCTCGATAAAGGTCTCAACACTCAAGATCTTGTCACCCTTTCTG
GGGGGCATACCATTGGCACCAGCGCC
TGCCAGTTCTTCCGTTACAGGCTGTACAATTTCAATTCCACCGGTGGGCCCGACCCCACCATCGCTGCCGCATTTCTTCCTACACTCCGGGCACTTTGTCCGGATGGCGGAGATGGGTCC
CGCCGGATAGGGCTCGACAACGGCAGCGAAAACCGGTTCGACAACACGTACTTCGCCAACTTGAGGAACGGCCGTGGAATTCTTGAATCGGATCAGAAACTATGGACCGATAGCTCGACC
AACACTTTTGTTCAGAGGTATCTGGGGGTGAGGGGTTTGTTGGGGTTGACTTTCAGCGTCGAATTCGGAAGGTCGATGGTGAAGATGAGTAATATTGAAGTCAAGACGGGGACTAACGGT
GAAATTCGTAGGGTTTGCTCTGCTATTAAT

Retrieve as FASTA