Entry information : MguPrx33 (mgv1a009857m)
Entry ID 9202
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2015-12-31 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-31 (Achraf Jemmat)
Peroxidase information: MguPrx33 (mgv1a009857m)
Name (synonym) MguPrx33 (mgv1a009857m)
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx33
start..stop
S start..stop
SaPrx21 499 7e-180 1..328 1..328
CroPrx36 478 1e-171 11..329 6..330
GmPrx64 468 2e-167 29..328 41..340
LjPrx50 463 2e-165 28..328 48..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 85845..86087 243 N° 2 86221..86964 744  
join(85845..86087,86221..86964)


exon

Literature and cross-references MguPrx33 (mgv1a009857m)
DNA ref. Phytozome 12:   scaffold_363 (85845..86964)
EST ref. GenBank:   GR015067.1 [5' end]   GR015068.1 [3' end]
Protein sequence: MguPrx33 (mgv1a009857m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   36576.47 (34016.1)  
PI (pH):   %s   8.53 (8.38) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKMGAGRGMIVGLLMMMVVVVAVEGGSREYEYDDALSYGYYHGNCPQLEGIIHRKLHNWFKNDSTLAPALMRLHFHDCSVRGCDASILLNHKGSERKAKASKTLRGFQVIDDIKSEVERVCPKIVSCADILTAAARDATVAAGGPFWSVPYGRKDGRISLAKEAESVPMGHEKITDLIELFQSKGLNILDLVVLSGAHTIGRTSCDSLQFRLYNYKGTSKPDPTIDPKYLNFLRRKCRWASEYVDLDAVTPKAFDVQYYKNLQKKMGILSTDQMLYSDSRTAPLVSAFASQSSVFHHQFAASMVKLGNIQDFLADQHSEIRLNCNYVNK

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1) and 9 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAATGGGGGCCGGGCGTGGAATGATAGTTGGGTTGTTGATGATGATGGTGGTGGTGGTAGCAGTTGAGGGGGGCAGCAGGGAATATGAATATGATGATGCTCTGAGTTATGGATAC
TACCATGGAAACTGTCCACAGCTTGAGGGTATCATCCACAGAAAGCTTCACAACTGGTTCAAAAATGACTCCACTCTTGCACCTGCTCTCATGAGGCTTCACTTCCACGACTGCTCCGTC
AGA
GTACGATATATCATATCGACGTCATTTTAAATATTTATTTCTTCTTCAATTCAATTCTTCTGAATTATAGACATATATGTATATTAATTAATTAATGAATGAATGAATGATCAATAT
ATACGTACGTACGTAGGGATGTGATGCATCTATTCTTCTGAACCACAAAGGAAGCGAGAGAAAGGCAAAGGCAAGCAAGACCCTTAGGGGTTTCCAAGTGATTGACGACATAAAGTCTGA
GGTTGAGAGAGTTTGCCCAAAGATAGTTTCATGCGCAGACATTCTAACTGCAGCTGCAAGAGATGCCACTGTTGCTGCTGGTGGACCCTTCTGGTCTGTTCCTTATGGCAGAAAAGACGG
CAGAATCTCATTAGCCAAGGAGGCTGAATCTGTACCTATGGGCCACGAGAAAATCACAGACCTCATCGAGCTTTTCCAGTCTAAGGGTTTGAACATACTTGACTTGGTTGTTCTCTCAGG
TGCCCACACCATTGGTAGAACCTCATGCGACTCATTGCAGTTCAGGCTCTACAACTACAAAGGTACTTCCAAACCCGACCCCACCATCGACCCTAAATATCTCAACTTCCTCAGAAGAAA
ATGCAGATGGGCTTCCGAGTACGTTGACCTAGACGCTGTCACACCAAAGGCATTCGACGTACAGTACTATAAGAACCTTCAGAAGAAAATGGGTATTCTTTCCACTGACCAGATGCTCTA
CTCCGACTCAAGGACTGCTCCCCTCGTCTCCGCCTTTGCTTCCCAATCTTCCGTCTTCCACCATCAGTTTGCTGCCTCAATGGTCAAGCTTGGAAACATTCAGGACTTTTTAGCCGACCA
ACACTCTGAAATTCGACTCAACTGCAACTATGTCAATAAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAATGGGGGCCGGGCGTGGAATGATAGTTGGGTTGTTGATGATGATGGTGGTGGTGGTAGCAGTTGAGGGGGGCAGCAGGGAATATGAATATGATGATGCTCTGAGTTATGGATAC
TACCATGGAAACTGTCCACAGCTTGAGGGTATCATCCACAGAAAGCTTCACAACTGGTTCAAAAATGACTCCACTCTTGCACCTGCTCTCATGAGGCTTCACTTCCACGACTGCTCCGTC
AGA
GGATGTGATGCATCTATTCTTCTGAACCACAAAGGAAGCGAGAGAAAGGCAAAGGCAAGCAAGACCCTTAGGGGTTTCCAAGTGATTGACGACATAAAGTCTGAGGTTGAGAGAGTT
TGCCCAAAGATAGTTTCATGCGCAGACATTCTAACTGCAGCTGCAAGAGATGCCACTGTTGCTGCTGGTGGACCCTTCTGGTCTGTTCCTTATGGCAGAAAAGACGGCAGAATCTCATTA
GCCAAGGAGGCTGAATCTGTACCTATGGGCCACGAGAAAATCACAGACCTCATCGAGCTTTTCCAGTCTAAGGGTTTGAACATACTTGACTTGGTTGTTCTCTCAGGTGCCCACACCATT
GGTAGAACCTCATGCGACTCATTGCAGTTCAGGCTCTACAACTACAAAGGTACTTCCAAACCCGACCCCACCATCGACCCTAAATATCTCAACTTCCTCAGAAGAAAATGCAGATGGGCT
TCCGAGTACGTTGACCTAGACGCTGTCACACCAAAGGCATTCGACGTACAGTACTATAAGAACCTTCAGAAGAAAATGGGTATTCTTTCCACTGACCAGATGCTCTACTCCGACTCAAGG
ACTGCTCCCCTCGTCTCCGCCTTTGCTTCCCAATCTTCCGTCTTCCACCATCAGTTTGCTGCCTCAATGGTCAAGCTTGGAAACATTCAGGACTTTTTAGCCGACCAACACTCTGAAATT
CGACTCAACTGCAACTATGTCAATAAG

Retrieve as FASTA