Entry information : MguPrx36 ( mgv1a009974m)
Entry ID 9205
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang LI)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: MguPrx36 ( mgv1a009974m)
Name (synonym) MguPrx36 ( mgv1a009974m)
Class Class III peroxidase    [Orthogroup: Prx089]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx36
start..stop
S start..stop
MguPrx12 657 0 1..323 1..323
MguPrx39 650 0 1..323 1..322
MguPrx44 646 0 1..323 1..322
MguPrx84 645 0 1..323 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 94374..94586 213 N° 2 94689..94877 189 N° 3 94973..95138 166 N° 4 95383..95783 401
join(94374..94586,94689..94877,94973..95138,95383..95783)


exon

Literature and cross-references MguPrx36 ( mgv1a009974m)
DNA ref. Phytozome 12:   scaffold_52 (94374..95783)
Protein sequence: MguPrx36 ( mgv1a009974m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   34600.69 (32092.3) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.1 (9.07) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKQILVFLVLVGIFNISCNAQGLKLGFYKKTCPSAEAIVKKETASIMAVAPTLAAPILRMHFHDCFVRGCDASILLNSTTNNQAEKDSFPNLSLRGYGSIDRVKSAVEKKCPGVVSCADILALVARDAVSLLNGASWPVPLGRRDGNVSNSTEVLFNLPPPFFNITQLKANFASKGLNAKDLVVLSGGHTIGTSHCSSFTNRLYNFTGVGDSDPSLDSNYVARLKTRCSATDTTTLVEMDPGSFKTFDTEYYTLVAKRRGLFTSDAALLADSETRAYVTSHATPQGSKDFLKDFAKSMVKMGKIGVLTGSQGEIRKTCG

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTATTTCTTGTACTAGTTGGCATATTCAACATATCATGTAATGCTCAAGGATTGAAGCTTGGCTTCTACAAGAAGACTTGTCCATCTGCTGAGGCG
ATCGTGAAAAAGGAAACTGCTAGTATTATGGCCGTTGCTCCAACTCTTGCCGCTCCTATTCTCAGAATGCATTTCCACGATTGTTTTGTTAGG
GTATGTTTACTTCAAATCAAATATCTC
ATATTGCATTTCCATTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGTAATAACTTTTGTTTTGCAGGGTTGTGATGCTTCTATTCTATTGAATTCGACAACAAATAATCAA
GCTGAGAAAGATTCATTTCCCAATCTATCCCTTAGAGGATATGGATCCATCGACAGAGTGAAATCCGCAGTGGAGAAGAAGTGCCCCGGTGTTGTTTCTTGTGCTGATATATTAGCTCTT
GTTGCACGAGATGCAGTTTCACTT
GTAAGTACTGCAGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT
TGAATGGAGCATCGTGGCCAGTGCCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAGGTTTTGTTCAATCTTCCACCTCCCTTTTTCAACATCACTCAATTGAAAGCTAACT
TTGCCTCAAAGGGTTTGAATGCAAAGGACCTTGTTGTTCTCTCGG
GTAATAATTATATACTCGTTTGTTTTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGTAACTAGCAAAAACCGTAAATATGCAGGAGGACACACAATAGGAACATCGCATTGCTCGAGTTTCACTAACCGCCTGTACAACTTCACCGGTGTTGGA
GACAGTGACCCTTCATTGGACTCTAACTACGTTGCTCGTTTGAAGACAAGATGCAGTGCGACCGATACCACTACACTTGTTGAAATGGACCCCGGAAGCTTTAAAACATTCGATACCGAG
TATTACACTCTTGTTGCTAAAAGAAGAGGACTTTTCACATCTGACGCAGCTCTTCTTGCCGACAGTGAAACTAGGGCTTACGTCACCAGCCATGCTACTCCTCAAGGGTCAAAGGATTTC
TTGAAGGACTTTGCAAAGTCAATGGTCAAAATGGGCAAAATTGGTGTGTTGACCGGGAGCCAAGGTGAAATCAGGAAAACATGTGGTTTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTATTTCTTGTACTAGTTGGCATATTCAACATATCATGTAATGCTCAAGGATTGAAGCTTGGCTTCTACAAGAAGACTTGTCCATCTGCTGAGGCG
ATCGTGAAAAAGGAAACTGCTAGTATTATGGCCGTTGCTCCAACTCTTGCCGCTCCTATTCTCAGAATGCATTTCCACGATTGTTTTGTTAGG
GGTTGTGATGCTTCTATTCTATTGAAT
TCGACAACAAATAATCAAGCTGAGAAAGATTCATTTCCCAATCTATCCCTTAGAGGATATGGATCCATCGACAGAGTGAAATCCGCAGTGGAGAAGAAGTGCCCCGGTGTTGTTTCTTGT
GCTGATATATTAGCTCTTGTTGCACGAGATGCAGTTTCACTT
TTGAATGGAGCATCGTGGCCAGTGCCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAGGTTTTGTTCAAT
CTTCCACCTCCCTTTTTCAACATCACTCAATTGAAAGCTAACTTTGCCTCAAAGGGTTTGAATGCAAAGGACCTTGTTGTTCTCTCGG
GAGGACACACAATAGGAACATCGCATTGCTCG
AGTTTCACTAACCGCCTGTACAACTTCACCGGTGTTGGAGACAGTGACCCTTCATTGGACTCTAACTACGTTGCTCGTTTGAAGACAAGATGCAGTGCGACCGATACCACTACACTTGTT
GAAATGGACCCCGGAAGCTTTAAAACATTCGATACCGAGTATTACACTCTTGTTGCTAAAAGAAGAGGACTTTTCACATCTGACGCAGCTCTTCTTGCCGACAGTGAAACTAGGGCTTAC
GTCACCAGCCATGCTACTCCTCAAGGGTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTCAAAATGGGCAAAATTGGTGTGTTGACCGGGAGCCAAGGTGAAATCAGGAAAACA
TGTGGTTTT

Retrieve as FASTA