Entry information : MguPrx39 ( mgv1a010031m)
Entry ID 9208
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: MguPrx39 ( mgv1a010031m)
Name (synonym) MguPrx39 ( mgv1a010031m)
Class Class III peroxidase    [Orthogroup: Prx089]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx39
start..stop
S start..stop
MguPrx84 651 0 1..322 1..322
MguPrx36 650 0 1..322 1..323
MguPrx44 647 0 1..322 1..322
MguPrx[P]72 643 0 1..322 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 89243..89452 210 N° 2 89550..89738 189 N° 3 89836..90001 166 N° 4 90225..90625 401
join(89243..89452,89550..89738,89836..90001,90225..90625)


exon

Literature and cross-references MguPrx39 ( mgv1a010031m)
DNA ref. Phytozome 12:   scaffold_52 (89243..90625)
Protein sequence: MguPrx39 ( mgv1a010031m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (300)
PWM (Da):   %s   34506.61 (32085.3) Transmb domain:   %s   i7-25o
PI (pH):   %s   9.1 (9.07) Peptide Signal:   %s   cut: 23 range:23-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKQILVFLVLVGIFNLCNAQGLKLGFYKKTCPTAEAIVKKETASIMAVAPTLAAPILRMHFHDCFVRGCDASILLNSTTNNQAEKDSFPNLSLRGYGSIDRVKSAVEKKCPGVVSCADILALVARDAVSFLNGASWPVPLGRRDGNVSNSTEALFNLPPPFFNITQLKASFASKGLNAKDLVVLSGGHTIGTSHCSSFTNRLYNFTGVGDSDPSLDSNYVARLKTRCSATDTTTLVEMDPGSFKTFDTEYYTLVAKRRGLFTSDAALLADSETRAYVTSHATPQGSKDFLKDFAKSMVKMGKIGVLTGSQGEIRKTCG

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTGTTTCTTGTTTTGGTTGGCATATTCAACTTATGCAATGCTCAAGGGTTGAAGCTTGGCTTCTACAAGAAGACTTGTCCAACTGCTGAGGCGATC
GTGAAAAAGGAGACTGCTAGTATTATGGCTGTTGCTCCAACTCTTGCTGCTCCTATTCTCAGAATGCATTTCCACGATTGTTTTGTTAGG
GTATATANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAATATATGTTTCTTTAGGTATTTTTATGTAGATGTACTAATTAGTTACTTTTGATAGGGTTGTGATGCTTCCATTCTATTGAATTCGACAACAAATAATCAAGCTGAGAA
AGATTCATTTCCCAATCTATCCCTTAGAGGATATGGATCCATCGACAGAGTGAAATCCGCAGTTGAGAAGAAGTGCCCCGGTGTTGTTTCTTGTGCTGATATATTAGCTCTTGTTGCACG
AGATGCAGTTTCATTT
GTAAGTACTGAAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATGCATATATTGTAAATTAGTTGAATG
GAGCATCGTGGCCAGTACCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAAGCTTTGTTCAATCTTCCCCCTCCTTTCTTCAACATCACTCAATTGAAAGCTAGCTTTGCCT
CAAAGGGTTTGAATGCAAAGGACCTTGTTGTTCTCTCCG
GTAATAATTATATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAACT
AACAAAAACCCTAAATATGCAGGAGGACACACCATAGGAACATCGCACTGCTCGAGTTTCACTAACCGCCTGTACAACTTCACCGGTGTTGGAGACAGTGACCCTTCATTGGACTCAAAC
TATGTTGCTCGTTTGAAGACAAGATGCAGTGCGACCGATACCACTACACTTGTCGAAATGGATCCTGGGAGTTTTAAAACATTCGACACCGAGTATTACACTCTTGTTGCTAAAAGAAGA
GGACTTTTCACATCTGACGCGGCTCTTCTTGCCGACAGTGAAACTAGGGCTTACGTCACCAGCCATGCTACTCCTCAGGGTTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTC
AAAATGGGCAAGATTGGTGTTTTGACAGGGAGCCAAGGTGAAATCAGGAAAACTTGTGGTTTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTGTTTCTTGTTTTGGTTGGCATATTCAACTTATGCAATGCTCAAGGGTTGAAGCTTGGCTTCTACAAGAAGACTTGTCCAACTGCTGAGGCGATC
GTGAAAAAGGAGACTGCTAGTATTATGGCTGTTGCTCCAACTCTTGCTGCTCCTATTCTCAGAATGCATTTCCACGATTGTTTTGTTAGG
GGTTGTGATGCTTCCATTCTATTGAATTCG
ACAACAAATAATCAAGCTGAGAAAGATTCATTTCCCAATCTATCCCTTAGAGGATATGGATCCATCGACAGAGTGAAATCCGCAGTTGAGAAGAAGTGCCCCGGTGTTGTTTCTTGTGCT
GATATATTAGCTCTTGTTGCACGAGATGCAGTTTCATTT
TTGAATGGAGCATCGTGGCCAGTACCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAAGCTTTGTTCAATCTT
CCCCCTCCTTTCTTCAACATCACTCAATTGAAAGCTAGCTTTGCCTCAAAGGGTTTGAATGCAAAGGACCTTGTTGTTCTCTCCG
GAGGACACACCATAGGAACATCGCACTGCTCGAGT
TTCACTAACCGCCTGTACAACTTCACCGGTGTTGGAGACAGTGACCCTTCATTGGACTCAAACTATGTTGCTCGTTTGAAGACAAGATGCAGTGCGACCGATACCACTACACTTGTCGAA
ATGGATCCTGGGAGTTTTAAAACATTCGACACCGAGTATTACACTCTTGTTGCTAAAAGAAGAGGACTTTTCACATCTGACGCGGCTCTTCTTGCCGACAGTGAAACTAGGGCTTACGTC
ACCAGCCATGCTACTCCTCAGGGTTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTCAAAATGGGCAAGATTGGTGTTTTGACAGGGAGCCAAGGTGAAATCAGGAAAACTTGT
GGTTTT

Retrieve as FASTA