Entry information : MguPrx40 ( mgv1a010045m)
Entry ID 9209
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2016-01-18 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-18 (Achraf Jemmat)
Peroxidase information: MguPrx40 ( mgv1a010045m)
Name (synonym) MguPrx40 ( mgv1a010045m)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx40
start..stop
S start..stop
SaPrx53 530 0 6..324 5..324
SaPrx54 522 0 6..324 5..324
SaPrx60 484 4e-174 6..324 5..323
MguPrx102 462 1e-165 1..324 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 185829..186038 210 N° 2 186335..186523 189 N° 3 186682..186847 166 N° 4 187261..187670 410
join(185829..186038,186335..186523,186682..186847,187261..187670)


exon

Literature and cross-references MguPrx40 ( mgv1a010045m)
DNA ref. Phytozome 12:   scaffold_52 (185829..187664)
Protein sequence: MguPrx40 ( mgv1a010045m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (302)
PWM (Da):   %s   35344.86 (32653.4)  
PI (pH):   %s   8.81 (8.75) Peptide Signal:   %s   cut: 23 range:23-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIITKLLFLCFLVFFFHHANAQNLALNFYRRTCPSVESIVNRTTASFISRAPSLAAALLRMHFHDCFVRGCDGSVLLNSTANNTAERDSIPNLSLRGFQVIDAVKTAVERSCPRTVSCADILALVARDAVSQIKGPFWQVPLGRRDGNVSISNEALTNLPPPFFNATQLVASFAAKGLDVKDLVVLSGGHTIGVSHCSSFTTRIYNFTGRNDADPTMDPNYVAALKARCPPTDTTTIVQMDPGSFDRFDTDYYTIVRKRRGLFESDAALLRNNVTNAYVQQHSSSSGSSSFFQDFAASMVKMGRIGVLTGTAGEIRRICSVAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATAATTACAAAGCTTCTTTTTCTTTGTTTTCTTGTCTTCTTCTTTCATCATGCTAATGCACAAAACCTTGCACTCAATTTCTATAGAAGGACATGCCCTTCTGTTGAATCTATC
GTAAATCGGACGACTGCGAGTTTCATTTCCCGTGCACCGTCTCTTGCTGCAGCACTCCTCCGGATGCATTTCCACGATTGTTTCGTTAGG
GTACGTTCTTCATATTTACTACTCTCTCCC
TCTTTTTTTTTTAAATTAAATTAGTTATTATAATAACCGTCGCGTTTTCGGCAATTGCTATGATGATTTATTTCCCATGTATTTCTAGGTATTTACTTTAATTGATCAAAATTATTTTCA
GTTCAACATATGCATACTATATATTAAATTCCAAAAATGGTCTAGATATAATAAAATGTCGTTGTATATACACACACACACGCGCACACGCGCGCGCTCGCTCGTGTTTATATATATGCA
TGAATTTAATTCATGTTGATATACAGGGATGTGATGGATCCGTACTTTTGAACTCGACCGCAAATAATACGGCTGAGAGGGATTCGATACCGAACCTGAGCCTTAGAGGCTTCCAAGTAA
TTGATGCCGTAAAAACTGCAGTGGAGAGAAGTTGCCCTAGAACAGTTTCTTGTGCCGATATTCTTGCTTTAGTTGCTCGAGACGCAGTTTCGCAG
GTTAACTTCATTTTATGTAAAAACT
TACTCAATTCGTACATATTTTAACCAGTGTATTTCACCAGGTGTAGCACTAGCTAGGATCGGACAACGTTTATATACACACGCATTTATATGTGTATTGAGGTTTCTCTTACATATGTAC
GTTTGTTATATAGATAAAGGGACCGTTTTGGCAAGTACCGTTGGGACGAAGAGACGGAAATGTGTCGATTTCCAACGAGGCGTTGACTAATCTCCCACCTCCGTTTTTCAACGCCACTCA
GCTCGTGGCATCATTTGCTGCAAAGGGATTAGATGTTAAGGATCTTGTTGTCTTGTCAG
GTAAAATCAAGATTTAAAAAAAAATAAAAATGGAAGAAAAAAAATGGAAAAAATACAGTTT
CCGTCTCCCAAGTTTCCACCAATTTCACATCTGGTCCCCCATGTTCACAAAAAACACATTTGGTCCCTCATGTTTCATAAGTTCAAACTTTTGGTTGTTTTCGTCAAATTTCCATATAGC
ACTAATGGAATCAAGAGTGTGCGTTGCACTGACTTAACTGACGGACTAAAGATAAATTGATGGCAAATGACCAAAAAGTGTTAATTTTATTGAAACATGAGGGACTAAATGTGATTTTTT
GTAAATATTGGGACCAAATGTGAAATCCGTGCAAACTTGAAGGACGAAAACTGTATTTTTCCCCAAAGAAAAATTATCAATGTAACTAACTATATCATTATTAATTTTTCAGGAGGGCAC
ACAATAGGGGTTTCACACTGCTCAAGCTTCACGACCCGAATATACAACTTCACGGGAAGAAACGACGCGGACCCCACAATGGACCCGAACTACGTGGCAGCACTAAAGGCGAGATGCCCG
CCTACGGACACGACCACCATAGTTCAGATGGACCCGGGTAGCTTCGACAGATTCGACACGGATTACTACACAATCGTAAGGAAAAGAAGGGGTCTTTTCGAGTCGGACGCAGCTCTGCTA
CGCAACAACGTGACCAATGCGTACGTGCAGCAGCATTCGAGTTCATCGGGATCGTCCAGTTTCTTTCAGGACTTTGCTGCATCGATGGTCAAGATGGGCCGGATTGGGGTGCTGACCGGA
ACAGCTGGTGAGATTAGGAGGATTTGTTCTGTTGCTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATAATTACAAAGCTTCTTTTTCTTTGTTTTCTTGTCTTCTTCTTTCATCATGCTAATGCACAAAACCTTGCACTCAATTTCTATAGAAGGACATGCCCTTCTGTTGAATCTATC
GTAAATCGGACGACTGCGAGTTTCATTTCCCGTGCACCGTCTCTTGCTGCAGCACTCCTCCGGATGCATTTCCACGATTGTTTCGTTAGG
GGATGTGATGGATCCGTACTTTTGAACTCG
ACCGCAAATAATACGGCTGAGAGGGATTCGATACCGAACCTGAGCCTTAGAGGCTTCCAAGTAATTGATGCCGTAAAAACTGCAGTGGAGAGAAGTTGCCCTAGAACAGTTTCTTGTGCC
GATATTCTTGCTTTAGTTGCTCGAGACGCAGTTTCGCAG
ATAAAGGGACCGTTTTGGCAAGTACCGTTGGGACGAAGAGACGGAAATGTGTCGATTTCCAACGAGGCGTTGACTAATCTC
CCACCTCCGTTTTTCAACGCCACTCAGCTCGTGGCATCATTTGCTGCAAAGGGATTAGATGTTAAGGATCTTGTTGTCTTGTCAG
GAGGGCACACAATAGGGGTTTCACACTGCTCAAGC
TTCACGACCCGAATATACAACTTCACGGGAAGAAACGACGCGGACCCCACAATGGACCCGAACTACGTGGCAGCACTAAAGGCGAGATGCCCGCCTACGGACACGACCACCATAGTTCAG
ATGGACCCGGGTAGCTTCGACAGATTCGACACGGATTACTACACAATCGTAAGGAAAAGAAGGGGTCTTTTCGAGTCGGACGCAGCTCTGCTACGCAACAACGTGACCAATGCGTACGTG
CAGCAGCATTCGAGTTCATCGGGATCGTCCAGTTTCTTTCAGGACTTTGCTGCATCGATGGTCAAGATGGGCCGGATTGGGGTGCTGACCGGAACAGCTGGTGAGATTAGGAGGATTTGT
TCTGTTGCTAATTAA

Retrieve as FASTA