Entry information : MguPrx41 (mgv1a010056m)
Entry ID 9210
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx41 (mgv1a010056m)
Name (synonym) MguPrx41 (mgv1a010056m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx41
start..stop
S start..stop
MguPrx64 637 0 1..324 1..324
MguPrx85 478 1e-171 7..324 5..320
MguPrx43 477 3e-171 11..324 13..323
SbaPrx02 472 2e-169 25..324 26..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 856188..856604 417 N° 2 855902..856070 169 N° 3 855399..855787 389  
complement(join(855399..855787,855902..856070,856188..856604))


exon

Literature and cross-references MguPrx41 (mgv1a010056m)
DNA ref. Phytozome 12:   scaffold_32 (856604..855399)
Protein sequence: MguPrx41 (mgv1a010056m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (297)
PWM (Da):   %s   34946.73 (32097.3)  
PI (pH):   %s   8.21 (8.40) Peptide Signal:   %s   cut: 28 range:28-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNYFATIFATSALALMLVLSHVPASEAQLSPPTFYDATCPNALATIRTSIRQAVSRERRMAGSLIRLHFHDCFVQGCDASILLDETATIRSEKTAFPNVNSVRGYEVIEAAKTLVERLCPGVVSCADILTLAARDASVAVGGPTWNVRLGRRDSTTANRDQANRDLPGPDSTLQRLIDSFGIKNNLTPRDMVALSGAHTLGLAQCSSFRTRIYSNGTNIDPGFATTRRRTCPQTGGDGNLAPLDLVTPNSFDNNYFRNLVQRRGLLQSDQVLLSGGSTDSIVTEYSTTPRTFAADFATAMIKMSEIEPVTGQSGIIRRICTAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTATTTCGCCACAATTTTCGCCACATCAGCACTAGCACTCATGCTCGTGCTCTCGCACGTGCCGGCATCAGAAGCGCAACTGTCTCCTCCGACGTTCTACGACGCAACATGCCCT
AACGCGCTCGCCACAATCCGAACATCAATCCGACAAGCAGTGTCGCGTGAGAGGCGAATGGCCGGCTCACTTATCCGCCTCCACTTCCACGACTGCTTCGTCCAGGGTTGCGACGCTTCG
ATCCTATTGGACGAGACCGCCACCATCCGATCCGAGAAAACCGCATTTCCGAACGTCAATTCCGTCAGAGGCTACGAAGTCATCGAGGCCGCCAAAACCCTAGTCGAGCGCTTATGCCCT
GGTGTCGTCTCTTGCGCCGATATACTAACCCTAGCTGCCCGTGATGCCTCCGTCGCT
GTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAGTTCGTTACTGCATTC
AGCACGTATTACCTCCNNNNNNNNNNNNNNNNNNNNNGATAACGAAAATTATAGGTTGGTGGTCCGACATGGAACGTGAGGTTGGGGAGAAGGGATTCGACCACGGCGAACCGTGACCAG
GCAAACAGGGATCTTCCGGGGCCTGATTCTACTCTCCAAAGACTTATCGATTCTTTCGGTATCAAAAATAATCTCACCCCTAGAGACATGGTTGCTTTATCAG
GTAATTGATTTCCCATG
ATCAATTAACAATTCTCTATACTGTATATATATAATCCGAAAAAATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTATGCAGGAGCACACACACTAGGTCTAGCC
CAATGCTCCTCGTTCCGCACGAGAATTTACAGCAACGGAACGAACATCGACCCAGGATTCGCTACCACTAGAAGACGCACTTGCCCGCAAACCGGAGGTGACGGAAATTTGGCGCCCCTA
GATTTGGTGACGCCTAATTCATTCGACAACAACTACTTTAGGAACTTGGTGCAGAGGAGGGGGCTTCTTCAGTCAGATCAAGTGCTTCTAAGCGGAGGATCAACCGACAGTATAGTGACG
GAATACAGTACTACTCCGAGAACTTTCGCGGCAGATTTCGCCACCGCAATGATTAAGATGAGTGAGATTGAGCCGGTTACCGGACAAAGTGGGATCATACGAAGGATTTGTACCGCCATC
AACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTATTTCGCCACAATTTTCGCCACATCAGCACTAGCACTCATGCTCGTGCTCTCGCACGTGCCGGCATCAGAAGCGCAACTGTCTCCTCCGACGTTCTACGACGCAACATGCCCT
AACGCGCTCGCCACAATCCGAACATCAATCCGACAAGCAGTGTCGCGTGAGAGGCGAATGGCCGGCTCACTTATCCGCCTCCACTTCCACGACTGCTTCGTCCAGGGTTGCGACGCTTCG
ATCCTATTGGACGAGACCGCCACCATCCGATCCGAGAAAACCGCATTTCCGAACGTCAATTCCGTCAGAGGCTACGAAGTCATCGAGGCCGCCAAAACCCTAGTCGAGCGCTTATGCCCT
GGTGTCGTCTCTTGCGCCGATATACTAACCCTAGCTGCCCGTGATGCCTCCGTCGCT
GTTGGTGGTCCGACATGGAACGTGAGGTTGGGGAGAAGGGATTCGACCACGGCGAACCGTGAC
CAGGCAAACAGGGATCTTCCGGGGCCTGATTCTACTCTCCAAAGACTTATCGATTCTTTCGGTATCAAAAATAATCTCACCCCTAGAGACATGGTTGCTTTATCAG
GAGCACACACACTA
GGTCTAGCCCAATGCTCCTCGTTCCGCACGAGAATTTACAGCAACGGAACGAACATCGACCCAGGATTCGCTACCACTAGAAGACGCACTTGCCCGCAAACCGGAGGTGACGGAAATTTG
GCGCCCCTAGATTTGGTGACGCCTAATTCATTCGACAACAACTACTTTAGGAACTTGGTGCAGAGGAGGGGGCTTCTTCAGTCAGATCAAGTGCTTCTAAGCGGAGGATCAACCGACAGT
ATAGTGACGGAATACAGTACTACTCCGAGAACTTTCGCGGCAGATTTCGCCACCGCAATGATTAAGATGAGTGAGATTGAGCCGGTTACCGGACAAAGTGGGATCATACGAAGGATTTGT
ACCGCCATCAACTAG

Retrieve as FASTA