Entry information : MguPrx43 (mgv1a010078m)
Entry ID 9212
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx43 (mgv1a010078m)
Name (synonym) MguPrx43 (mgv1a010078m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx43
start..stop
S start..stop
MguPrx85 531 0 7..323 1..320
MguPrx14 516 0 7..318 1..315
SaPrx01 484 2e-174 10..323 10..321
MguPrx41 477 3e-171 13..323 11..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 836374..836793 420 N° 2 835840..836005 166 N° 3 835230..835615 386  
complement(join(835230..835615,835840..836005,836374..836793))


exon

Literature and cross-references MguPrx43 (mgv1a010078m)
DNA ref. Phytozome 11:   scaffold_32 (836793..835230)
Protein sequence: MguPrx43 (mgv1a010078m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (294)
PWM (Da):   %s   34820.85 (31644.1) Transmb domain:   %s   i12-34o
PI (pH):   %s   8.94 (8.76) Peptide Signal:   %s   cut: 30 range:30-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSSSIKKYIFSAIFLFSIFVVLPLSEAQLSATFYDRTCPTAVTIIRNSIRQAVSRERRMAASLIRLHFHDCFVQGCDASILLDETPTIQSEKTAIPNVNSARGYEVIEAAKLLVERACPGVVSCADVLTLAAREASVAVSGPSWTVRLGRRDSTTANRAQANSDLPSPFAGLNGLISSFANKGLNTREMVALSGSHTLGQAQCFLFRARVYSNGTDIDPNFASERRRGCPQTGGNANLAPLDLVTPNSFDNNYFRNIVLRRGLLQSDQILLTGATTSIVTEYSTNPRTFSTDFANAMIKMSEISPLLGSAGIIRRVCSAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTCTTCTTCGATAAAAAAATACATTTTCTCGGCGATATTTCTATTCAGCATCTTCGTCGTACTTCCACTAAGCGAAGCACAGCTGTCTGCAACATTCTACGACCGAACATGC
CCTACTGCGGTCACCATTATCCGAAACTCAATTCGACAAGCAGTGTCACGTGAGAGGCGCATGGCGGCCTCGCTCATTCGGCTCCACTTCCACGACTGCTTCGTTCAGGGCTGCGATGCT
TCGATCCTATTGGACGAGACCCCCACCATTCAGTCCGAGAAAACCGCTATCCCTAATGTGAACTCCGCCAGAGGGTACGAAGTGATCGAAGCGGCCAAACTTCTCGTCGAGCGTGCATGC
CCCGGCGTCGTTTCTTGCGCCGACGTACTAACCCTAGCTGCACGAGAAGCCTCTGTTGCT
GTAAGTACATATATTTATATATATCATGCGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTATACGTAAGCTAGCACTTCAACAATCATCAAATTCTTGATTTTATTTTCATGTTCACGTTGTGTTACANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTTTGTATATATATTAAAATTCAAGCCNNNNNNNNNNNNNNNNNNNNNCGCAGGTTAGCGGTCCATCGTGGACGGTGAGGCTAGGAAGAAGAGACTCGACAACAG
CGAACCGCGCGCAGGCAAACTCCGATCTACCGAGTCCGTTTGCCGGTCTGAACGGTCTCATCTCGTCTTTCGCGAATAAGGGACTCAACACAAGGGAAATGGTTGCCCTATCAG
GTAGGT
TAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGAACACACCATTAATTAATTTGATCGATGATTAATATATGTACATGTGCATGCATGCATGCAGGATCACACACACTAGGTCAAGC
TCAATGCTTCTTGTTCCGAGCGAGAGTATACAGCAACGGCACCGACATCGATCCCAATTTTGCCAGCGAGAGAAGACGCGGGTGCCCTCAAACGGGGGGTAACGCGAATCTGGCCCCCCT
CGATTTGGTGACACCTAACTCGTTCGACAATAATTATTTCAGAAATATTGTGCTGCGAAGGGGTCTTCTCCAATCGGATCAAATACTTCTTACCGGTGCCACAACTAGCATCGTCACGGA
GTACAGCACAAACCCTAGAACTTTTTCGACTGATTTCGCCAACGCAATGATTAAAATGTCCGAGATTTCGCCCCTCCTCGGAAGCGCTGGAATCATTAGAAGGGTTTGCAGCGCAATCAA
CTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTCTTCTTCGATAAAAAAATACATTTTCTCGGCGATATTTCTATTCAGCATCTTCGTCGTACTTCCACTAAGCGAAGCACAGCTGTCTGCAACATTCTACGACCGAACATGC
CCTACTGCGGTCACCATTATCCGAAACTCAATTCGACAAGCAGTGTCACGTGAGAGGCGCATGGCGGCCTCGCTCATTCGGCTCCACTTCCACGACTGCTTCGTTCAGGGCTGCGATGCT
TCGATCCTATTGGACGAGACCCCCACCATTCAGTCCGAGAAAACCGCTATCCCTAATGTGAACTCCGCCAGAGGGTACGAAGTGATCGAAGCGGCCAAACTTCTCGTCGAGCGTGCATGC
CCCGGCGTCGTTTCTTGCGCCGACGTACTAACCCTAGCTGCACGAGAAGCCTCTGTTGCT
GTTAGCGGTCCATCGTGGACGGTGAGGCTAGGAAGAAGAGACTCGACAACAGCGAACCGC
GCGCAGGCAAACTCCGATCTACCGAGTCCGTTTGCCGGTCTGAACGGTCTCATCTCGTCTTTCGCGAATAAGGGACTCAACACAAGGGAAATGGTTGCCCTATCAG
GATCACACACACTA
GGTCAAGCTCAATGCTTCTTGTTCCGAGCGAGAGTATACAGCAACGGCACCGACATCGATCCCAATTTTGCCAGCGAGAGAAGACGCGGGTGCCCTCAAACGGGGGGTAACGCGAATCTG
GCCCCCCTCGATTTGGTGACACCTAACTCGTTCGACAATAATTATTTCAGAAATATTGTGCTGCGAAGGGGTCTTCTCCAATCGGATCAAATACTTCTTACCGGTGCCACAACTAGCATC
GTCACGGAGTACAGCACAAACCCTAGAACTTTTTCGACTGATTTCGCCAACGCAATGATTAAAATGTCCGAGATTTCGCCCCTCCTCGGAAGCGCTGGAATCATTAGAAGGGTTTGCAGC
GCAATCAACTAG

Retrieve as FASTA