Entry information : MguPrx44 ( Migut.M00404 / mgv1a010112m)
Entry ID 9213
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2013-12-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: MguPrx44 ( Migut.M00404 / mgv1a010112m)
Name (synonym) MguPrx44 ( Migut.M00404 / mgv1a010112m)
Class Class III peroxidase    [Orthogroup: Prx089]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx44
start..stop
S start..stop
MguPrx84 660 0 1..324 1..324
MguPrx[P]72 652 0 1..324 1..324
MguPrx39 647 0 1..322 1..322
MguPrx36 646 0 1..322 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6520464..6520673 210 N° 2 6520006..6520194 189 N° 3 6519714..6519879 166 N° 4 6519220..6519629 410
complement(join(6519220..6519629,6519714..6519879,6520006..6520194,6520464..6520 673))


exon

Literature and cross-references MguPrx44 ( Migut.M00404 / mgv1a010112m)
DNA ref. Phytozome 12:   scaffold_13 (6519220..6520673)   scaffold_52 (142885..144338)
Protein sequence: MguPrx44 ( Migut.M00404 / mgv1a010112m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (302)
PWM (Da):   %s   34900.76 (32343.4) Transmb domain:   %s   i7-25o
PI (pH):   %s   9.1 (9.07) Peptide Signal:   %s   cut: 23 range:23-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKQILVFLVFVGIFNTCNAQGLKLGFYKKTCPSAEAIVKKETANIMSVAPTLAAPLLRMHFHDCFVRGCDASILLNSTTNSQAEKDSFPNLSLRGYGSIDRVKSAVEKKCPGVVSCADILALVARDAVSLLNGASWPVPLGRRDGNVSNSTETLFNLPPPFFNITQLKASFASKGLNAKDLVVLSGGHTIGTSHCSSFTNRLYNFTGVGDSDPSLDSNYVARLKTRCSATDTTTLVEMDPGSFKTFDTEYYTLVAKRRGLFTSDAALLADSETRAYVTSHATPQGSKDFLKDFAKSMVKMGKIGVLTGSQGEIRKTCGFIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTATTTCTTGTTTTCGTTGGAATATTCAACACATGTAATGCTCAAGGATTGAAACTTGGCTTCTACAAGAAAACTTGTCCATCAGCTGAAGCAATC
GTGAAAAAAGAAACTGCAAATATTATGTCTGTTGCTCCAACTCTTGCTGCTCCTCTTCTCAGAATGCATTTCCACGATTGTTTCGTTAGA
GTATGTTTTCTTAAGCTCTCTTCTCTTATA
TTTATATTCTCTTCATAACTACTTAATGGATATATGTTTGTAAGCATTTTTTGCTTAAATTACAATCGGAATCCTACTCATATTCATACACCTCTACCTTCCTAATGGAGGGTGAGAACT
GATTTAATCATATGGTTGGGAGTGGCATTTTAGAGCACTGCATAAACAATATTCTAAGTAACTTCTAGACGAAGTTAAGTACAATTGAGAGGAACTAATTAGTTACTTATTACATACAGG
GTTGTGACGCTTCTATTCTACTGAACTCAACAACAAATAGTCAAGCTGAGAAAGATTCATTCCCCAATCTATCCCTTAGAGGATATGGATCCATCGACAGAGTGAAATCCGCAGTGGAGA
AGAAGTGCCCCGGTGTTGTTTCTTGTGCCGATATATTAGCTCTCGTTGCACGAGATGCAGTTTCACTT
GTTAGTACTGCAAATGATTACACACACACATATATTATATACATTTTATTTA
TTTATATAAATAAAATAAAATTTTGTTTATACAAAATTATACTTATTTATTTGAATGTATATATTGTGAATTAGTTGAATGGAGCATCGTGGCCAGTACCATTGGGAAGAAGAGATGGAA
ATGTATCAAACAGCACAGAAACTTTGTTCAATCTTCCACCTCCTTTCTTCAACATCACTCAATTGAAAGCTAGCTTTGCCTCAAAGGGTTTGAATGCAAAGGATCTTGTTGTTCTCTCGG
GTAATAATCATTTATCACTTATTTTATTAATTAATTACATTATTTTTTTTTTTAAATTTTGTTCTAAAAACCCTAAATTTGCAGGAGGACACACCATAGGAACATCACACTGCTCGAGTT
TCACTAACCGCCTGTACAACTTCACCGGCGTCGGAGACAGTGACCCTTCATTGGACTCGAACTATGTTGCTCGTTTGAAGACAAGATGCAGTGCGACTGATACCACTACACTTGTTGAAA
TGGACCCCGGAAGCTTTAAAACATTCGATACCGAGTATTACACTCTTGTTGCTAAAAGAAGAGGACTTTTCACATCTGACGCAGCTCTTCTTGCTGACAGTGAAACTAGGGCTTACGTCA
CCAGTCATGCTACTCCTCAAGGGTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTCAAAATGGGCAAGATTGGTGTTTTGACAGGGAGCCAAGGTGAAATTAGGAAAACTTGTG
GTTTCATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTATTTCTTGTTTTCGTTGGAATATTCAACACATGTAATGCTCAAGGATTGAAACTTGGCTTCTACAAGAAAACTTGTCCATCAGCTGAAGCAATC
GTGAAAAAAGAAACTGCAAATATTATGTCTGTTGCTCCAACTCTTGCTGCTCCTCTTCTCAGAATGCATTTCCACGATTGTTTCGTTAGA
GGTTGTGACGCTTCTATTCTACTGAACTCA
ACAACAAATAGTCAAGCTGAGAAAGATTCATTCCCCAATCTATCCCTTAGAGGATATGGATCCATCGACAGAGTGAAATCCGCAGTGGAGAAGAAGTGCCCCGGTGTTGTTTCTTGTGCC
GATATATTAGCTCTCGTTGCACGAGATGCAGTTTCACTT
TTGAATGGAGCATCGTGGCCAGTACCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAAACTTTGTTCAATCTT
CCACCTCCTTTCTTCAACATCACTCAATTGAAAGCTAGCTTTGCCTCAAAGGGTTTGAATGCAAAGGATCTTGTTGTTCTCTCGG
GAGGACACACCATAGGAACATCACACTGCTCGAGT
TTCACTAACCGCCTGTACAACTTCACCGGCGTCGGAGACAGTGACCCTTCATTGGACTCGAACTATGTTGCTCGTTTGAAGACAAGATGCAGTGCGACTGATACCACTACACTTGTTGAA
ATGGACCCCGGAAGCTTTAAAACATTCGATACCGAGTATTACACTCTTGTTGCTAAAAGAAGAGGACTTTTCACATCTGACGCAGCTCTTCTTGCTGACAGTGAAACTAGGGCTTACGTC
ACCAGTCATGCTACTCCTCAAGGGTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTCAAAATGGGCAAGATTGGTGTTTTGACAGGGAGCCAAGGTGAAATTAGGAAAACTTGT
GGTTTCATTAATTAA

Retrieve as FASTA