Entry information : MguPrx45 (mgv1a010125m)
Entry ID 9214
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx45 (mgv1a010125m)
Name (synonym) MguPrx45 (mgv1a010125m)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx45
start..stop
S start..stop
SaPrx03 518 0 1..320 1..319
CroPrx40 499 2e-180 5..320 6..318
SaPrx14 499 4e-180 7..320 3..315
CpapPrx26 491 4e-177 1..319 5..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4366230..4366442 213 N° 2 4365950..4366138 189 N° 3 4365673..4365835 163 N° 4 4365191..4365588 398
complement(join(4365191..4365588,4365673..4365835,4365950..4366138,4366230..4366 442))


exon

Literature and cross-references MguPrx45 (mgv1a010125m)
DNA ref. Phytozome 12:   scaffold_2 (4366442..4365191)
Protein sequence: MguPrx45 (mgv1a010125m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (296)
PWM (Da):   %s   34761.2 (32144.8)  
PI (pH):   %s   7.76 (7.47) Peptide Signal:   %s   cut: 26 range:26-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKFVSLLVTMFVFASTLISSSNALSLNYYDQTCPNAETAIAEAVHKGMINDKTVPAALLRMHFHDCFIRGCDGSVLLNSTVKNQAEKDGPPNISLHAFYVIDNAKKQVEKMCPGVVSCADILALAARDAVSLSGGPNWNVPKGRKDGRISIANDSLQLPFPTFNISQLQQSFSQRGLSIDDLVALSGGHTLGFSHCSSFQNRIHNFNNKTDVDPSMDPSFASSLRQVCPMHNTVKNAGSFLDTSPTVFDNAYYKMLVQGKSIFSSDQALLTNSRTQALVQKYAASQPEFYEAFANSMVKMSSINGAGTEIRLDCRSIN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAATTTGTTTCCTTGTTAGTTACTATGTTTGTTTTTGCATCAACTTTGATCAGCTCTTCAAATGCACTGAGTTTGAATTACTACGACCAAACATGCCCTAACGCCGAGACG
GCCATCGCAGAAGCCGTGCACAAAGGCATGATCAACGACAAAACGGTTCCGGCAGCTTTACTTAGGATGCACTTCCATGATTGTTTCATCAGG
GTAAGTAAACAAATTAAAAAAAAACAA
TTATCTGTCGTAAGTATATTCGACTTTAAATTGATTAGTTTGTGTAATTATTTATTTTTTGAAGGGTTGTGATGGTTCTGTGCTGCTGAATTCGACGGTGAAAAACCAGGCCGAAAAAGA
CGGACCTCCGAATATTTCGTTGCATGCATTTTATGTTATTGATAATGCAAAGAAACAAGTCGAGAAAATGTGCCCCGGTGTCGTTTCTTGTGCTGATATTTTAGCTCTGGCTGCTAGGGA
TGCAGTTTCACTT
GTAAGTATTATTCCTTATTAGTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACAAATTGAAGAGGTTAATTAACTAATTATATTT
TAATTAGTCTGGAGGTCCCAATTGGAATGTGCCTAAAGGGAGAAAAGATGGAAGAATTTCAATTGCCAATGATTCACTACAATTACCATTTCCCACATTCAATATATCTCAATTACAACA
GAGCTTTTCTCAAAGAGGCCTTTCTATTGATGATCTAGTGGCACTCTCAG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACACTCNNNNNNNNNNNN
NNNNNNNNNNGCAGGAGGGCACACACTTGGATTCTCCCACTGTTCATCATTCCAAAACAGAATCCACAACTTCAACAATAAAACGGACGTCGATCCGTCGATGGATCCATCGTTTGCTTC
CAGCTTAAGGCAAGTTTGCCCGATGCATAACACGGTGAAAAATGCGGGTTCATTTCTAGATACTTCGCCGACGGTTTTCGATAATGCCTACTACAAAATGCTGGTACAAGGGAAGAGCAT
TTTCTCTTCGGACCAGGCACTTCTTACTAATTCCAGGACACAGGCTTTGGTACAGAAGTATGCTGCCTCTCAGCCCGAGTTTTACGAGGCGTTTGCGAACTCGATGGTGAAGATGAGCAG
CATCAATGGTGCTGGAACTGAGATTAGACTCGATTGTAGATCTATCAATCAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAATTTGTTTCCTTGTTAGTTACTATGTTTGTTTTTGCATCAACTTTGATCAGCTCTTCAAATGCACTGAGTTTGAATTACTACGACCAAACATGCCCTAACGCCGAGACG
GCCATCGCAGAAGCCGTGCACAAAGGCATGATCAACGACAAAACGGTTCCGGCAGCTTTACTTAGGATGCACTTCCATGATTGTTTCATCAGG
GGTTGTGATGGTTCTGTGCTGCTGAAT
TCGACGGTGAAAAACCAGGCCGAAAAAGACGGACCTCCGAATATTTCGTTGCATGCATTTTATGTTATTGATAATGCAAAGAAACAAGTCGAGAAAATGTGCCCCGGTGTCGTTTCTTGT
GCTGATATTTTAGCTCTGGCTGCTAGGGATGCAGTTTCACTT
TCTGGAGGTCCCAATTGGAATGTGCCTAAAGGGAGAAAAGATGGAAGAATTTCAATTGCCAATGATTCACTACAATTA
CCATTTCCCACATTCAATATATCTCAATTACAACAGAGCTTTTCTCAAAGAGGCCTTTCTATTGATGATCTAGTGGCACTCTCAG
GAGGGCACACACTTGGATTCTCCCACTGTTCATCA
TTCCAAAACAGAATCCACAACTTCAACAATAAAACGGACGTCGATCCGTCGATGGATCCATCGTTTGCTTCCAGCTTAAGGCAAGTTTGCCCGATGCATAACACGGTGAAAAATGCGGGT
TCATTTCTAGATACTTCGCCGACGGTTTTCGATAATGCCTACTACAAAATGCTGGTACAAGGGAAGAGCATTTTCTCTTCGGACCAGGCACTTCTTACTAATTCCAGGACACAGGCTTTG
GTACAGAAGTATGCTGCCTCTCAGCCCGAGTTTTACGAGGCGTTTGCGAACTCGATGGTGAAGATGAGCAGCATCAATGGTGCTGGAACTGAGATTAGACTCGATTGTAGATCTATCAAT
CAT

Retrieve as FASTA